ID: 1005755851

View in Genome Browser
Species Human (GRCh38)
Location 6:28924230-28924252
Sequence GAAACCCAACAAAAGACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005755851_1005755855 -9 Left 1005755851 6:28924230-28924252 CCCCTCGTCTTTTGTTGGGTTTC No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755851_1005755862 23 Left 1005755851 6:28924230-28924252 CCCCTCGTCTTTTGTTGGGTTTC No data
Right 1005755862 6:28924276-28924298 CTGCAAAAGAAAGCTGGCTTTGG No data
1005755851_1005755858 17 Left 1005755851 6:28924230-28924252 CCCCTCGTCTTTTGTTGGGTTTC No data
Right 1005755858 6:28924270-28924292 CAGCCCCTGCAAAAGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005755851 Original CRISPR GAAACCCAACAAAAGACGAG GGG (reversed) Intergenic
No off target data available for this crispr