ID: 1005755855

View in Genome Browser
Species Human (GRCh38)
Location 6:28924244-28924266
Sequence TTGGGTTTCCTCTTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005755840_1005755855 27 Left 1005755840 6:28924194-28924216 CCGGGCCTACAAACTTCAGCGGC No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755846_1005755855 2 Left 1005755846 6:28924219-28924241 CCGGGCCCGGGCCCCTCGTCTTT No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755851_1005755855 -9 Left 1005755851 6:28924230-28924252 CCCCTCGTCTTTTGTTGGGTTTC No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755841_1005755855 22 Left 1005755841 6:28924199-28924221 CCTACAAACTTCAGCGGCTGCCG No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755847_1005755855 -3 Left 1005755847 6:28924224-28924246 CCCGGGCCCCTCGTCTTTTGTTG No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755848_1005755855 -4 Left 1005755848 6:28924225-28924247 CCGGGCCCCTCGTCTTTTGTTGG No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data
1005755852_1005755855 -10 Left 1005755852 6:28924231-28924253 CCCTCGTCTTTTGTTGGGTTTCC No data
Right 1005755855 6:28924244-28924266 TTGGGTTTCCTCTTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005755855 Original CRISPR TTGGGTTTCCTCTTGGTGCC AGG Intergenic
No off target data available for this crispr