ID: 1005758861

View in Genome Browser
Species Human (GRCh38)
Location 6:28949880-28949902
Sequence GAGCCTTCCCCCGCCTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005758861_1005758866 15 Left 1005758861 6:28949880-28949902 CCCACGGAGGCGGGGGAAGGCTC No data
Right 1005758866 6:28949918-28949940 CAGTCCCGAAGCCTGCCCCGCGG No data
1005758861_1005758872 29 Left 1005758861 6:28949880-28949902 CCCACGGAGGCGGGGGAAGGCTC No data
Right 1005758872 6:28949932-28949954 GCCCCGCGGGAAGGCAACTAAGG No data
1005758861_1005758870 20 Left 1005758861 6:28949880-28949902 CCCACGGAGGCGGGGGAAGGCTC No data
Right 1005758870 6:28949923-28949945 CCGAAGCCTGCCCCGCGGGAAGG No data
1005758861_1005758867 16 Left 1005758861 6:28949880-28949902 CCCACGGAGGCGGGGGAAGGCTC No data
Right 1005758867 6:28949919-28949941 AGTCCCGAAGCCTGCCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005758861 Original CRISPR GAGCCTTCCCCCGCCTCCGT GGG (reversed) Intergenic