ID: 1005758862

View in Genome Browser
Species Human (GRCh38)
Location 6:28949881-28949903
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005758862_1005758867 15 Left 1005758862 6:28949881-28949903 CCACGGAGGCGGGGGAAGGCTCA No data
Right 1005758867 6:28949919-28949941 AGTCCCGAAGCCTGCCCCGCGGG No data
1005758862_1005758866 14 Left 1005758862 6:28949881-28949903 CCACGGAGGCGGGGGAAGGCTCA No data
Right 1005758866 6:28949918-28949940 CAGTCCCGAAGCCTGCCCCGCGG No data
1005758862_1005758870 19 Left 1005758862 6:28949881-28949903 CCACGGAGGCGGGGGAAGGCTCA No data
Right 1005758870 6:28949923-28949945 CCGAAGCCTGCCCCGCGGGAAGG No data
1005758862_1005758872 28 Left 1005758862 6:28949881-28949903 CCACGGAGGCGGGGGAAGGCTCA No data
Right 1005758872 6:28949932-28949954 GCCCCGCGGGAAGGCAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005758862 Original CRISPR TGAGCCTTCCCCCGCCTCCG TGG (reversed) Intergenic