ID: 1005758867

View in Genome Browser
Species Human (GRCh38)
Location 6:28949919-28949941
Sequence AGTCCCGAAGCCTGCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005758861_1005758867 16 Left 1005758861 6:28949880-28949902 CCCACGGAGGCGGGGGAAGGCTC No data
Right 1005758867 6:28949919-28949941 AGTCCCGAAGCCTGCCCCGCGGG No data
1005758862_1005758867 15 Left 1005758862 6:28949881-28949903 CCACGGAGGCGGGGGAAGGCTCA No data
Right 1005758867 6:28949919-28949941 AGTCCCGAAGCCTGCCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005758867 Original CRISPR AGTCCCGAAGCCTGCCCCGC GGG Intergenic