ID: 1005764243

View in Genome Browser
Species Human (GRCh38)
Location 6:28995273-28995295
Sequence GGATTCTTTTGTGCTGCCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 3, 3: 12, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005764239_1005764243 14 Left 1005764239 6:28995236-28995258 CCACACTCACTGCAGGTGTATGG 0: 1
1: 1
2: 4
3: 27
4: 234
Right 1005764243 6:28995273-28995295 GGATTCTTTTGTGCTGCCTCAGG 0: 1
1: 1
2: 3
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005764243 Original CRISPR GGATTCTTTTGTGCTGCCTC AGG Exonic
901077502 1:6564464-6564486 GGGTGCTTTTGGGCTGGCTCTGG + Intronic
904065411 1:27746418-27746440 AGATTCTTATGTGCTACCTATGG - Intronic
904440577 1:30526974-30526996 GGATGCTTTTCTGCAGCATCAGG - Intergenic
905382010 1:37569250-37569272 GGATTGTTCTGGGCTGCTTCTGG + Exonic
909409929 1:75338188-75338210 GGGGCCTTTTGTGATGCCTCCGG - Intronic
910529467 1:88219063-88219085 GGATTCTTTTCTGAAGGCTCTGG - Intergenic
911138544 1:94470401-94470423 GGATTCTGTTGTGCAGCTCCAGG + Intronic
911294368 1:96096522-96096544 AGATGCATTTGTGTTGCCTCTGG - Intergenic
913046396 1:115076859-115076881 GCATTCTGGTGGGCTGCCTCTGG - Intronic
913689391 1:121264576-121264598 AGCTTCTTTTCTGTTGCCTCTGG + Intronic
914148206 1:145015695-145015717 AGCTTCTTTTCTGTTGCCTCTGG - Intronic
914380363 1:147110124-147110146 GGACTGTTTTTTGCTTCCTCTGG - Intergenic
915427238 1:155836908-155836930 GTATTCCTTTGTGCTGACTCTGG + Intronic
916239948 1:162629488-162629510 GGATGCTTTTGTGATGCCTCAGG - Intergenic
916334596 1:163656196-163656218 GGACTCTTTAGTCCAGCCTCAGG - Intergenic
918846364 1:189620073-189620095 GGGTTCTTTAGTGCTGCTTCTGG - Intergenic
919097991 1:193059803-193059825 GGAGCCTTTTGTGCGGCCCCAGG + Intronic
919748300 1:201022040-201022062 TGATTCTTGAGTGCTGCCTAGGG + Intronic
919876969 1:201876386-201876408 GGATTATTTTGCCCCGCCTCAGG + Exonic
920009095 1:202854868-202854890 GGCTTCTTGTGTTCTGCGTCTGG - Intergenic
920476717 1:206283053-206283075 AGCTTCTTTTCTGTTGCCTCTGG + Intronic
922786758 1:228286718-228286740 GGATCCTGTCGTGCTGCCGCTGG - Intronic
923389166 1:233496772-233496794 GGATTATTTTGTTTTTCCTCTGG + Intergenic
1065039372 10:21675984-21676006 GAATTCTTTTTTTCTGCCACAGG - Intronic
1066491991 10:35902818-35902840 GGATTCTAAGGTGCTGGCTCTGG - Intergenic
1068611510 10:59065439-59065461 AGATTCTTCTCTTCTGCCTCTGG + Intergenic
1068616585 10:59125065-59125087 AAATTCCTTTGTGCTGCTTCTGG + Intergenic
1069156939 10:65041277-65041299 GGATACTTTTGTGATATCTCTGG - Intergenic
1069345001 10:67458433-67458455 GGATTATTCTATGCTGCCTGTGG + Intronic
1069708806 10:70476268-70476290 TGATTCTTTCGTTCTGCCTGGGG + Intergenic
1069980770 10:72250940-72250962 GGATTCTTCTGTGCTGTGTAAGG + Intergenic
1071927522 10:90427757-90427779 GGATTCTGATGTGATGCCTCAGG + Intergenic
1074620165 10:115110523-115110545 GGATGCTTTTCTGGAGCCTCTGG + Intronic
1075073000 10:119331247-119331269 GGATTCTTCTGTTCTGCCGGAGG + Intronic
1076702822 10:132283061-132283083 GGATTCTTCTCTGCTGCCCCCGG - Intronic
1077554367 11:3218875-3218897 GGAGTCTTTTGTGCCCCCGCTGG + Intergenic
1078544128 11:12234595-12234617 GTGTTGTTTTGTGCTGCCTGGGG + Intronic
1084203357 11:67576898-67576920 GCACTCTTTGGTGTTGCCTCAGG + Intergenic
1086263220 11:84966372-84966394 GGGTTCTGTTGTGGTGCCTCAGG - Intronic
1089571263 11:119412022-119412044 GCATTCTTTTCTCCTCCCTCTGG + Intergenic
1091294491 11:134464038-134464060 GGATTCTTTAGTGCTTCCTCTGG + Intergenic
1092769561 12:11884365-11884387 GGATTCTTTTTTGATTCTTCTGG + Intronic
1096859759 12:54516820-54516842 GCTTTCTTCTGTGCTGCCTGTGG + Intronic
1097429485 12:59486914-59486936 GGTCTCCTTTGTGCTGCCTCAGG + Intergenic
1099479775 12:83151194-83151216 GCATTCTTCTGCCCTGCCTCAGG - Intergenic
1100021623 12:90075905-90075927 GGTTTCTTTGGTGCAGCCTGTGG + Intergenic
1106417973 13:29561723-29561745 GGATTCTTCGGTGATGCCTGGGG - Intronic
1111690192 13:91554539-91554561 GGATTCGTTTGTCCTACCTTAGG - Intronic
1111879036 13:93931829-93931851 GGTTTCTTCTGTGTTGTCTCTGG + Intronic
1112878427 13:104075028-104075050 GAATTCTTTGGTGTGGCCTCTGG - Intergenic
1113310136 13:109123275-109123297 GGAGTCTATTGTCCCGCCTCCGG - Intronic
1115923787 14:38408022-38408044 GGATGCTTGTGTGTTGCCTAGGG - Intergenic
1121794895 14:96726564-96726586 GGATTCTCCTCTGCAGCCTCTGG + Intergenic
1125718833 15:41835487-41835509 GGATTCTTCTGTGCTCACCCAGG + Intronic
1126786596 15:52182081-52182103 GGATTTACTTGTGGTGCCTCAGG + Intronic
1128916609 15:71568405-71568427 GGATTCTATTTTGCTGAATCAGG + Intronic
1130645402 15:85721351-85721373 GGATCAATTTGTGTTGCCTCTGG + Intronic
1132752316 16:1464460-1464482 TGATACGTTTGTGCTGCCTCTGG - Intronic
1136000117 16:27286091-27286113 GGTTTCTTGTGTGCTGGCTCAGG + Intronic
1143355028 17:6321298-6321320 GGAGTCTTGTGTGCTGCTGCAGG + Intergenic
1143451564 17:7039794-7039816 GGCTTCTTTTGTGGTGGCTGGGG + Exonic
1149195919 17:54120495-54120517 GAATTCTTCAGTGATGCCTCTGG + Intergenic
1149425777 17:56552958-56552980 GGATTGTTGTGTGCATCCTCTGG - Intergenic
1150933180 17:69607345-69607367 GGATTATCTTGTGCAGCCTGTGG - Intergenic
1152550130 17:81025410-81025432 AGAGTCCTTTGTGCGGCCTCAGG - Intergenic
1153645853 18:7195462-7195484 GAAGACATTTGTGCTGCCTCAGG - Intergenic
1153703359 18:7718926-7718948 GAATTCTTTTATGCTGCTTGTGG + Intronic
1157285622 18:46375189-46375211 GCATTCTTTTGTGCTGTCACTGG + Intronic
1159088848 18:63823783-63823805 GGCTGCACTTGTGCTGCCTCAGG + Intergenic
1162787167 19:13042936-13042958 GGATCCTTGCGTGCTGCCTGAGG - Intronic
1168589486 19:57620857-57620879 GGATTCTCTTGTGCTGAGTAAGG - Exonic
925719466 2:6813411-6813433 GGGTTGTTTTGTGCTGCTGCTGG - Intergenic
926279871 2:11437072-11437094 TGATTCTTTTGAGCCTCCTCAGG - Intergenic
926441851 2:12897441-12897463 GGTTTCTTATGGGCTGCTTCTGG - Intergenic
926958394 2:18327666-18327688 CTATTCTTCTGTGCTCCCTCAGG + Intronic
930027715 2:47039512-47039534 GGATATTTTTGTGGTGTCTCTGG - Intronic
931063773 2:58561492-58561514 GCATTCGTTTTTTCTGCCTCTGG - Intergenic
932010080 2:67967567-67967589 CAATAATTTTGTGCTGCCTCAGG + Intergenic
933383347 2:81579621-81579643 GGCTTCCTGTGTTCTGCCTCAGG + Intergenic
934493237 2:94776603-94776625 GGTTTCCTGTGTGCAGCCTCAGG - Intergenic
942499400 2:176572928-176572950 GGATTCTCTTGTGCTGTCCTTGG - Intergenic
943554467 2:189385466-189385488 CCATTTATTTGTGCTGCCTCTGG - Intergenic
943687148 2:190830428-190830450 TCATACTTTTGTGCTGCCTTTGG - Intergenic
943706594 2:191041759-191041781 GTCTTCTTTTCTGCAGCCTCAGG - Intronic
1169465186 20:5831637-5831659 CGAATCTTTGCTGCTGCCTCAGG - Intronic
1170219491 20:13926794-13926816 GCATTCCTTTTTGCTGCTTCTGG - Intronic
1171068947 20:22047253-22047275 GGATTCTGTTGATCTTCCTCTGG - Intergenic
1172691997 20:36796555-36796577 GGATTCTTTTCTCCTGCCTCTGG - Intronic
1174745259 20:53055873-53055895 GGCTGCTTTTGTGCTACCCCAGG + Intronic
1174811125 20:53646824-53646846 GAATTCTTGAGTGTTGCCTCTGG - Intergenic
1179643883 21:42763725-42763747 GCAGTCTTTCTTGCTGCCTCTGG - Intronic
1180245636 21:46545676-46545698 GGATGCTTGTTTCCTGCCTCAGG + Intronic
1180820562 22:18824332-18824354 GCATTCTTTTGTCCGGCTTCTGG + Intergenic
1181206786 22:21258804-21258826 GCATTCTTTTGTCCGGCTTCTGG + Intergenic
1181268858 22:21646993-21647015 GGGCTCTTTTGTTCTGCTTCAGG - Intergenic
1181411175 22:22720862-22720884 GGTTTCTTCTGAGCTGACTCAGG + Intergenic
1181719509 22:24763087-24763109 GGATGCTTCTCTGCTGACTCGGG - Intronic
1181879839 22:25969394-25969416 GTATTTTATGGTGCTGCCTCAGG - Intronic
1182934644 22:34209517-34209539 GAAGTCATTTGTGCTGCATCAGG - Intergenic
1184225376 22:43126697-43126719 GGATTTTTTTTTTCAGCCTCAGG + Intronic
1184577370 22:45381380-45381402 GGTATCTTTTCTTCTGCCTCAGG - Intronic
1203220138 22_KI270731v1_random:36619-36641 GCATTCTTTTGTCCGGCTTCTGG - Intergenic
1203270688 22_KI270734v1_random:50207-50229 GCATTCTTTTGTCCGGCTTCTGG + Intergenic
950116456 3:10453525-10453547 GGATGCTTTTCTGCTTCCCCTGG + Intronic
952743947 3:36760778-36760800 GGATTCTGTTTGGCTGCCTGGGG - Intergenic
953504191 3:43468005-43468027 GTACTCTTTTGTGGTGCCTGGGG + Intronic
954274739 3:49534928-49534950 GGATTTGTGTGTGCTGCCTCAGG + Exonic
958889612 3:99769019-99769041 GGTTGCTTTTGTGGTGCCTGTGG + Intronic
961106440 3:124246479-124246501 TGATTCTTTAGTTTTGCCTCTGG + Intronic
963454337 3:145523717-145523739 GTTTTCTTTGGTGCTGCTTCTGG - Intergenic
963772223 3:149399211-149399233 TCATTCTTCTGGGCTGCCTCTGG - Intergenic
964307077 3:155353435-155353457 AGATTCTTTTGTAAAGCCTCAGG - Intergenic
965415988 3:168393081-168393103 GCATTCCTTTTTGCTGCCTATGG - Intergenic
967329021 3:188271944-188271966 GGTTTCTTTAGTGTTGCCCCTGG - Intronic
967687855 3:192438507-192438529 GGAATCCTTAGTTCTGCCTCTGG - Intronic
970062767 4:12053678-12053700 GGATTCTGTGATGTTGCCTCAGG + Intergenic
970212657 4:13726869-13726891 TGATACTTTTGTGCTTCCTGAGG - Intergenic
970252015 4:14126565-14126587 GAATCCTTTGGTGCTGCCTGAGG - Intergenic
972478250 4:39473688-39473710 GGATATTTTTCTGTTGCCTCTGG - Intronic
975106444 4:70573104-70573126 AGATTCTTTTGTGGGGCCTGAGG - Intergenic
976876617 4:89861176-89861198 GTGCTCTTTTGTTCTGCCTCAGG + Intergenic
977293771 4:95190896-95190918 GGAATCTCTTGTCCTGCCTTTGG - Intronic
992150733 5:73899952-73899974 GAATTCTTTAGTGATGCCTTTGG + Intronic
992202009 5:74394078-74394100 TGGTTCTGTTGTGCTACCTCAGG + Intergenic
992306645 5:75447031-75447053 AGAATCTTTTGTGCTCACTCTGG + Intronic
997107698 5:131039901-131039923 GAATTCTTTTGTTCTACATCAGG + Intergenic
997734095 5:136200800-136200822 GGCTGCTTTTGAGCTGCCTGTGG + Intergenic
1000356074 5:160397139-160397161 ATATTCTTTTGTTCTGCTTCTGG - Intronic
1003278518 6:4672913-4672935 TGATGCTTTTGTGTTGCCTTGGG - Intergenic
1004990640 6:21134080-21134102 GTGCTCTTTTGTGCTGCCTCTGG + Intronic
1005679211 6:28188989-28189011 GGATTCTTTTGTGCTTCCTCAGG - Intergenic
1005764243 6:28995273-28995295 GGATTCTTTTGTGCTGCCTCAGG + Exonic
1006174749 6:32115189-32115211 TGATTCTTTGATGCTGGCTCTGG + Intronic
1007743292 6:44026070-44026092 GGAGCCTTCTGTGCTGCCTTAGG + Intergenic
1008664804 6:53705661-53705683 GTTTTCTTTTGAGCTGCCCCTGG - Intergenic
1011983982 6:93419291-93419313 GGATTATTTTATGCTACATCTGG - Exonic
1015254629 6:131164195-131164217 TTTTTCTATTGTGCTGCCTCAGG + Intronic
1015602165 6:134921276-134921298 AGCTTCTTCTGTGCTTCCTCCGG + Intronic
1017205793 6:151803587-151803609 GGATTTTTTTTTACTGCTTCAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023895031 7:44426258-44426280 GGTTTCTTTTATGCCTCCTCAGG - Intronic
1025039543 7:55629234-55629256 GGATTCATATGTGCTGCTTGCGG + Intergenic
1027532767 7:79355216-79355238 GTCTTCTTTTATGCTGCCTGGGG - Intronic
1031140405 7:117936375-117936397 GGAATCCGTTGTTCTGCCTCGGG - Intergenic
1033524552 7:142197328-142197350 TGATTCTTTTCTGATGCCACTGG + Intronic
1033788712 7:144765566-144765588 GGATGCTTTTCTGCTACCACTGG + Intronic
1037324087 8:17671361-17671383 GGATTCTTTTCTGTTTCCTATGG - Intronic
1038580348 8:28743100-28743122 GTATTCTTATGTGATGCCCCAGG + Exonic
1039380398 8:37079657-37079679 TGATTTTTTTTTTCTGCCTCTGG + Intergenic
1040381074 8:46873849-46873871 GGCTTCTTTTGTGGTGTCACAGG - Intergenic
1041625244 8:60018175-60018197 GGCTTCATTTGTTCTGCTTCAGG - Intergenic
1043109335 8:76158743-76158765 GAATTCTTCTGTGATTCCTCAGG + Intergenic
1047668906 8:127123251-127123273 AGAAGCTTTTGCGCTGCCTCAGG + Intergenic
1048329572 8:133462788-133462810 GCATTGGGTTGTGCTGCCTCAGG - Intronic
1048809184 8:138269705-138269727 GGATTCTGTAGTCCTGCCTAAGG - Intronic
1050380517 9:5023478-5023500 AAATGCTTTTGTGCTGTCTCTGG + Intronic
1050990124 9:12139685-12139707 GGATCTTTATGTGCTGCCTGTGG - Intergenic
1058383836 9:104409735-104409757 GGTTTCTTTTTTCCTGCTTCTGG + Intergenic
1058564747 9:106270607-106270629 GGATTCTTTTGTCCAACCACAGG - Intergenic
1059971976 9:119677520-119677542 GGATTCCTTCCTGATGCCTCTGG - Intergenic
1060812834 9:126619553-126619575 GGCTTCTATGGTGCTGTCTCTGG + Intronic
1186031880 X:5377116-5377138 GGATTCATTTGGACTGCCTGGGG + Intergenic
1186075015 X:5868838-5868860 GGGTTCGGTTGTGCTGTCTCTGG + Intronic
1186235585 X:7505203-7505225 AGATTATTTTGTGCTTCATCAGG - Intergenic
1186931858 X:14400877-14400899 GAATTCTCTTTTGCAGCCTCAGG + Intergenic
1188816617 X:34722816-34722838 GGAGTCTGTTGGGCTTCCTCTGG + Intergenic
1189176909 X:38966727-38966749 GGAGTCTTCTGTTCTGCATCTGG - Intergenic
1191952741 X:66611095-66611117 GGTTTATCTTGTGCTGCCTCAGG - Intronic
1194908294 X:99606562-99606584 TGATTCTTTTATACTGTCTCAGG - Intergenic
1196063360 X:111434917-111434939 GCTTTCTTTTTTGCTGCATCAGG - Intergenic
1200869327 Y:8080149-8080171 GGCTTCTTTTGTGGTGTCACAGG + Intergenic
1201601515 Y:15733814-15733836 AGATCATTTTGTGCTGCATCAGG - Intergenic