ID: 1005775675

View in Genome Browser
Species Human (GRCh38)
Location 6:29129306-29129328
Sequence TCCCACTGCAGCCAACGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005775675_1005775679 -10 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775679 6:29129319-29129341 TGCAGTGGGAGAGGTGCGGGTGG No data
1005775675_1005775683 17 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775683 6:29129346-29129368 GTGCGCTCGATGGAGCCCGAAGG No data
1005775675_1005775685 24 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775685 6:29129353-29129375 CGATGGAGCCCGAAGGAGCTGGG No data
1005775675_1005775686 30 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775686 6:29129359-29129381 AGCCCGAAGGAGCTGGGAACAGG No data
1005775675_1005775684 23 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775684 6:29129352-29129374 TCGATGGAGCCCGAAGGAGCTGG No data
1005775675_1005775681 -8 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775681 6:29129321-29129343 CAGTGGGAGAGGTGCGGGTGGGG No data
1005775675_1005775680 -9 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775680 6:29129320-29129342 GCAGTGGGAGAGGTGCGGGTGGG No data
1005775675_1005775682 7 Left 1005775675 6:29129306-29129328 CCATGACGTTGGCTGCAGTGGGA No data
Right 1005775682 6:29129336-29129358 GGGTGGGGCTGTGCGCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005775675 Original CRISPR TCCCACTGCAGCCAACGTCA TGG (reversed) Intergenic
No off target data available for this crispr