ID: 1005776061

View in Genome Browser
Species Human (GRCh38)
Location 6:29131710-29131732
Sequence GTCAGCTAACACCTTTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005776061_1005776069 -7 Left 1005776061 6:29131710-29131732 CCCCCATAAAGGTGTTAGCTGAC No data
Right 1005776069 6:29131726-29131748 AGCTGACAGGGGGATCTCCCTGG No data
1005776061_1005776070 -1 Left 1005776061 6:29131710-29131732 CCCCCATAAAGGTGTTAGCTGAC No data
Right 1005776070 6:29131732-29131754 CAGGGGGATCTCCCTGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005776061 Original CRISPR GTCAGCTAACACCTTTATGG GGG (reversed) Intergenic
No off target data available for this crispr