ID: 1005779027

View in Genome Browser
Species Human (GRCh38)
Location 6:29168950-29168972
Sequence CTGGCTCTGATGGGCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005779021_1005779027 29 Left 1005779021 6:29168898-29168920 CCTCTAATTTGGTTTTAACGTCT No data
Right 1005779027 6:29168950-29168972 CTGGCTCTGATGGGCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005779027 Original CRISPR CTGGCTCTGATGGGCTCCAG TGG Intergenic
No off target data available for this crispr