ID: 1005783398

View in Genome Browser
Species Human (GRCh38)
Location 6:29217529-29217551
Sequence GCTCCATCCTTGGCTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005783394_1005783398 13 Left 1005783394 6:29217493-29217515 CCTTGGGACATGGTGCCCGGTGT No data
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data
1005783396_1005783398 -3 Left 1005783396 6:29217509-29217531 CCGGTGTCTTATCTGCTTCAGCT No data
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data
1005783390_1005783398 28 Left 1005783390 6:29217478-29217500 CCCTGCTCTATGCAGCCTTGGGA 0: 18
1: 73
2: 197
3: 731
4: 988
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data
1005783388_1005783398 29 Left 1005783388 6:29217477-29217499 CCCCTGCTCTATGCAGCCTTGGG 0: 15
1: 101
2: 216
3: 586
4: 1458
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data
1005783395_1005783398 -2 Left 1005783395 6:29217508-29217530 CCCGGTGTCTTATCTGCTTCAGC No data
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data
1005783391_1005783398 27 Left 1005783391 6:29217479-29217501 CCTGCTCTATGCAGCCTTGGGAC 0: 18
1: 62
2: 167
3: 389
4: 559
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data
1005783386_1005783398 30 Left 1005783386 6:29217476-29217498 CCCCCTGCTCTATGCAGCCTTGG 0: 9
1: 64
2: 208
3: 549
4: 1357
Right 1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005783398 Original CRISPR GCTCCATCCTTGGCTAAAAG AGG Intergenic
No off target data available for this crispr