ID: 1005786213

View in Genome Browser
Species Human (GRCh38)
Location 6:29248303-29248325
Sequence CCTAACAAAGGCCCTCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005786213_1005786220 13 Left 1005786213 6:29248303-29248325 CCTTAAGGAGGGCCTTTGTTAGG No data
Right 1005786220 6:29248339-29248361 TGGAAGAGCCTTGTGTGGTAAGG No data
1005786213_1005786219 8 Left 1005786213 6:29248303-29248325 CCTTAAGGAGGGCCTTTGTTAGG No data
Right 1005786219 6:29248334-29248356 GATAATGGAAGAGCCTTGTGTGG No data
1005786213_1005786218 -7 Left 1005786213 6:29248303-29248325 CCTTAAGGAGGGCCTTTGTTAGG No data
Right 1005786218 6:29248319-29248341 TGTTAGGGAGGCATTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005786213 Original CRISPR CCTAACAAAGGCCCTCCTTA AGG (reversed) Intergenic
No off target data available for this crispr