ID: 1005805388

View in Genome Browser
Species Human (GRCh38)
Location 6:29469704-29469726
Sequence GTGGTGAGAGCCAACATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005805388_1005805391 10 Left 1005805388 6:29469704-29469726 CCAAGAATGTTGGCTCTCACCAC No data
Right 1005805391 6:29469737-29469759 GTCTTAAGAAGATACCATCAGGG No data
1005805388_1005805392 16 Left 1005805388 6:29469704-29469726 CCAAGAATGTTGGCTCTCACCAC No data
Right 1005805392 6:29469743-29469765 AGAAGATACCATCAGGGCAAAGG No data
1005805388_1005805390 9 Left 1005805388 6:29469704-29469726 CCAAGAATGTTGGCTCTCACCAC No data
Right 1005805390 6:29469736-29469758 CGTCTTAAGAAGATACCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005805388 Original CRISPR GTGGTGAGAGCCAACATTCT TGG (reversed) Intergenic
No off target data available for this crispr