ID: 1005805978

View in Genome Browser
Species Human (GRCh38)
Location 6:29474969-29474991
Sequence GGCAGTCCCTGCCTTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005805971_1005805978 22 Left 1005805971 6:29474924-29474946 CCAGCATGTTTTCCAGACATGAT No data
Right 1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG No data
1005805973_1005805978 -1 Left 1005805973 6:29474947-29474969 CCCTTTTACAGCCTTGTGCATAG No data
Right 1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG No data
1005805972_1005805978 10 Left 1005805972 6:29474936-29474958 CCAGACATGATCCCTTTTACAGC No data
Right 1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG No data
1005805974_1005805978 -2 Left 1005805974 6:29474948-29474970 CCTTTTACAGCCTTGTGCATAGG No data
Right 1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005805978 Original CRISPR GGCAGTCCCTGCCTTTGTGG AGG Intergenic
No off target data available for this crispr