ID: 1005806246

View in Genome Browser
Species Human (GRCh38)
Location 6:29476624-29476646
Sequence TCACCTGGAAGGTGACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005806246_1005806250 22 Left 1005806246 6:29476624-29476646 CCTCAGGGTCACCTTCCAGGTGA No data
Right 1005806250 6:29476669-29476691 ACATTGCACTCTTGACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005806246 Original CRISPR TCACCTGGAAGGTGACCCTG AGG (reversed) Intergenic
No off target data available for this crispr