ID: 1005807552

View in Genome Browser
Species Human (GRCh38)
Location 6:29488603-29488625
Sequence TACCCAAGGATGCCCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005807552_1005807558 20 Left 1005807552 6:29488603-29488625 CCAGTCCTGGGCATCCTTGGGTA No data
Right 1005807558 6:29488646-29488668 GCCACAGTATGGCATTTCCCTGG No data
1005807552_1005807560 21 Left 1005807552 6:29488603-29488625 CCAGTCCTGGGCATCCTTGGGTA No data
Right 1005807560 6:29488647-29488669 CCACAGTATGGCATTTCCCTGGG No data
1005807552_1005807557 9 Left 1005807552 6:29488603-29488625 CCAGTCCTGGGCATCCTTGGGTA No data
Right 1005807557 6:29488635-29488657 GATGCAGCAGTGCCACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005807552 Original CRISPR TACCCAAGGATGCCCAGGAC TGG (reversed) Intergenic
No off target data available for this crispr