ID: 1005807812

View in Genome Browser
Species Human (GRCh38)
Location 6:29491325-29491347
Sequence ACTCCATAGTGGGGCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005807812_1005807821 25 Left 1005807812 6:29491325-29491347 CCCTTGATGCCCCACTATGGAGT No data
Right 1005807821 6:29491373-29491395 CTTGAGAGGTGAAACGCTCTGGG No data
1005807812_1005807819 11 Left 1005807812 6:29491325-29491347 CCCTTGATGCCCCACTATGGAGT No data
Right 1005807819 6:29491359-29491381 AAGAACTTAGGATGCTTGAGAGG No data
1005807812_1005807820 24 Left 1005807812 6:29491325-29491347 CCCTTGATGCCCCACTATGGAGT No data
Right 1005807820 6:29491372-29491394 GCTTGAGAGGTGAAACGCTCTGG No data
1005807812_1005807817 -1 Left 1005807812 6:29491325-29491347 CCCTTGATGCCCCACTATGGAGT No data
Right 1005807817 6:29491347-29491369 TCCAGAACACTGAAGAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005807812 Original CRISPR ACTCCATAGTGGGGCATCAA GGG (reversed) Intergenic
No off target data available for this crispr