ID: 1005808155

View in Genome Browser
Species Human (GRCh38)
Location 6:29494361-29494383
Sequence TCCCTAGGATGAGGGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005808155_1005808166 21 Left 1005808155 6:29494361-29494383 CCCTGACTCCCTCATCCTAGGGA No data
Right 1005808166 6:29494405-29494427 GAGTAGACCCAGTTCCAAGTTGG No data
1005808155_1005808164 -1 Left 1005808155 6:29494361-29494383 CCCTGACTCCCTCATCCTAGGGA No data
Right 1005808164 6:29494383-29494405 ACAGGGAATAGGGCCTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005808155 Original CRISPR TCCCTAGGATGAGGGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr