ID: 1005814795

View in Genome Browser
Species Human (GRCh38)
Location 6:29541768-29541790
Sequence GTGCAGAAATGGAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005814795_1005814800 9 Left 1005814795 6:29541768-29541790 CCATCTACCTTCCATTTCTGCAC No data
Right 1005814800 6:29541800-29541822 TTCTGGACATGTCCTATTAGTGG No data
1005814795_1005814798 -8 Left 1005814795 6:29541768-29541790 CCATCTACCTTCCATTTCTGCAC No data
Right 1005814798 6:29541783-29541805 TTCTGCACATTCACCTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005814795 Original CRISPR GTGCAGAAATGGAAGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr