ID: 1005816651

View in Genome Browser
Species Human (GRCh38)
Location 6:29558585-29558607
Sequence TGGCAAACGGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 44, 2: 81, 3: 103, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005816651_1005816662 22 Left 1005816651 6:29558585-29558607 CCATCCACCACTGCCGTTTGCCA 0: 1
1: 44
2: 81
3: 103
4: 231
Right 1005816662 6:29558630-29558652 TTCCATCCCTCGGATCTGGCAGG 0: 1
1: 1
2: 3
3: 10
4: 94
1005816651_1005816663 23 Left 1005816651 6:29558585-29558607 CCATCCACCACTGCCGTTTGCCA 0: 1
1: 44
2: 81
3: 103
4: 231
Right 1005816663 6:29558631-29558653 TCCATCCCTCGGATCTGGCAGGG No data
1005816651_1005816661 18 Left 1005816651 6:29558585-29558607 CCATCCACCACTGCCGTTTGCCA 0: 1
1: 44
2: 81
3: 103
4: 231
Right 1005816661 6:29558626-29558648 TGACTTCCATCCCTCGGATCTGG No data
1005816651_1005816660 12 Left 1005816651 6:29558585-29558607 CCATCCACCACTGCCGTTTGCCA 0: 1
1: 44
2: 81
3: 103
4: 231
Right 1005816660 6:29558620-29558642 CGCGGCTGACTTCCATCCCTCGG 0: 1
1: 2
2: 1
3: 8
4: 63
1005816651_1005816655 -6 Left 1005816651 6:29558585-29558607 CCATCCACCACTGCCGTTTGCCA 0: 1
1: 44
2: 81
3: 103
4: 231
Right 1005816655 6:29558602-29558624 TTGCCACCGTCGCAGACCCGCGG 0: 1
1: 0
2: 5
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005816651 Original CRISPR TGGCAAACGGCAGTGGTGGA TGG (reversed) Intronic
900999951 1:6143933-6143955 TGGGAAACGGCATTGGAGGCAGG + Intronic
902832947 1:19029481-19029503 TGGGAAACGACAGTGGGGCAGGG - Intergenic
903298397 1:22360658-22360680 AGGCAACAGGCAGTGGTGGCAGG + Intergenic
906417867 1:45635817-45635839 GGGCAAACGGCAGAGGAGGTGGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909923687 1:81413149-81413171 AGGCAAACGGCTGAGGTGGGTGG - Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
915166565 1:153951371-153951393 GGGCACACGGCGGTGGTGGGGGG + Exonic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920044720 1:203125927-203125949 TGGGAACAGGCAGGGGTGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
921579546 1:216879787-216879809 TGGAAAAGGGCAGTGGGAGATGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1063984220 10:11483696-11483718 AGGCAAAAGGCAGTGTTGGGGGG + Intronic
1064351707 10:14583130-14583152 TGGTAAACGGCAGACCTGGAAGG + Intronic
1065168421 10:23004795-23004817 TGGAGTACGGCAGTGGTGGCAGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065731934 10:28717441-28717463 TGGAAACTGGCAATGGTGGAAGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075209374 10:120478079-120478101 TGGCAAAGGGCAATGCGGGAGGG - Intronic
1076014830 10:127019172-127019194 GGGCAAATGGCAGGGTTGGATGG + Intronic
1076025519 10:127108894-127108916 TGGTAAATGGCAGTGGTTCAAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081975794 11:47233954-47233976 TGGCAAAAGGCAGTGTAGCATGG + Intronic
1082044057 11:47710606-47710628 TTGCAAAGGGCTGTGGTGGTGGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085508737 11:77074627-77074649 TGGCAAAAGGTGGTGGTGGGGGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089639705 11:119839650-119839672 GGGTAAACGACAGTGATGGATGG + Intergenic
1090414763 11:126533376-126533398 TGGCCAAGGGCAGTGGGAGAGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099299214 12:80870241-80870263 TGGCAAATGGCAGTGTTTTAAGG - Intronic
1100451108 12:94707165-94707187 TGGCAAACGACAATGGTCCAGGG + Intergenic
1101225711 12:102686319-102686341 GGGGAAAGGGCAGTGGTGGTAGG - Intergenic
1101254099 12:102960573-102960595 TGTCAAAGGGAAGAGGTGGATGG + Intergenic
1102383481 12:112486806-112486828 TGGCCAATGGCAGTGCTGTAGGG - Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105548670 13:21371184-21371206 GGGCAAAAGGCAGTGAAGGAGGG - Intergenic
1105836648 13:24217893-24217915 TGGCAGTGGGCAGTGGTGGTGGG - Intronic
1106224721 13:27776207-27776229 TGGCAGGAGGCAGTGATGGATGG - Intergenic
1106606661 13:31235030-31235052 TCTCAAACTGCTGTGGTGGAGGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108431746 13:50360397-50360419 GGTCACACGGCAGTGGTGGCAGG - Intronic
1108547256 13:51508304-51508326 TGGCAAAAGGTAGAGTTGGAGGG - Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1109960815 13:69627465-69627487 TTGCAAAAGGCAAGGGTGGATGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113534720 13:111056598-111056620 TGGCAAATAGCAGCAGTGGATGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115232242 14:31173598-31173620 TTGGAATCTGCAGTGGTGGATGG + Exonic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118438525 14:65792391-65792413 TGTGAGACGGGAGTGGTGGAGGG + Intergenic
1118844355 14:69535488-69535510 TGGGAGACGGCGGGGGTGGAGGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124895132 15:33769444-33769466 TGGCAAACCCCACTGGTGGGTGG + Intronic
1125445177 15:39746555-39746577 TGGTAAATGGCAGGTGTGGATGG + Intronic
1125933535 15:43616391-43616413 TGGCAGATGGCAGTGGTGCTGGG + Exonic
1125946633 15:43715853-43715875 TGGCAGATGGCAGTGGTGCTGGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129365595 15:75052012-75052034 TGGTAAAGGGCAGTGCTAGAAGG - Intronic
1129691177 15:77714475-77714497 TGGCAAAGGGCAGTGGCAGGGGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133641384 16:7720658-7720680 TGTCAAAGGGCTGAGGTGGAAGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136257129 16:29048823-29048845 TGGCAAAGTGCAGTAGTGAACGG + Intronic
1136379042 16:29883095-29883117 TGGCACTCGGCTGTGATGGATGG - Intronic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1140648749 16:77064302-77064324 TGGCCAACGCCAGAGGTGGGAGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142381101 16:89732711-89732733 GGGCAAACGGCAGAGGACGAGGG - Intronic
1144474296 17:15571954-15571976 TGGGAAACGGCGGTGGGGGGAGG + Exonic
1144819170 17:18059411-18059433 TGGGAAAAGGATGTGGTGGAGGG - Intronic
1146978295 17:37135349-37135371 TGGCAAACTGGAGTGCTGGCTGG + Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1147987457 17:44314833-44314855 TGCCTGACGGCAGTGGTGGAGGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152293158 17:79452272-79452294 GGGCAATCGGCAGTGCAGGATGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154086514 18:11310630-11310652 AGGCAGAGGGCAGGGGTGGATGG + Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160579928 18:79877912-79877934 TGGGCAAGGGCAGTGGAGGATGG - Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168481994 19:56727942-56727964 TGACAACTGGCAGTGGGGGAGGG + Intergenic
1168484744 19:56751411-56751433 TGGAAACAGGCAGTGGGGGAGGG + Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925189937 2:1874689-1874711 TGGCAAACGGCACGGGCAGAGGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927882028 2:26695721-26695743 TGGGAAACGGCAGAGGAAGAGGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929695741 2:44113754-44113776 TTGAATATGGCAGTGGTGGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934764188 2:96870991-96871013 GGGCAAAAGGCAGAGGTGAAGGG + Intergenic
934816582 2:97332378-97332400 TGGAAAGGGTCAGTGGTGGAGGG + Intergenic
934821114 2:97376106-97376128 TGGAAAGGGTCAGTGGTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936607443 2:113972580-113972602 TGGGGAAAGGCAGTGGAGGAAGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
938645375 2:133325124-133325146 TTGAATACGGCAGTGATGGAAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
939514961 2:143154921-143154943 TGGCAGATGGCAGTGGATGAAGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940858093 2:158745441-158745463 TGGCTGAACGCAGTGGTGGAAGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944992606 2:205255022-205255044 TGGCAAAAGGCAAGGCTGGAAGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946650719 2:221890644-221890666 TGACAAAGGGCAGGGATGGAAGG + Intergenic
946669622 2:222088902-222088924 TGGGAAGTGGCAGAGGTGGAAGG - Intergenic
946759829 2:222982657-222982679 TCGCAAATGGGAGTGGGGGAAGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172385448 20:34530927-34530949 TGTCAAAAGGCAGTGGCAGATGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1174708977 20:52685192-52685214 TGGCAGAGTGCAGTGGGGGAAGG + Intergenic
1174772801 20:53317083-53317105 TAGCAAAAGGCAGTGGTCCAAGG + Intronic
1175283490 20:57820984-57821006 TTGCAGAGGGCAGGGGTGGAAGG + Intergenic
1175377490 20:58538857-58538879 TGTCAATAGGCAGTGGTAGAGGG + Intergenic
1176961398 21:15163179-15163201 TGGCACAGGGGAGTGCTGGATGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177611904 21:23460616-23460638 TGGCAAACGGACCTGGTGGGAGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178826807 21:36024218-36024240 TTGGGAAAGGCAGTGGTGGAGGG - Intergenic
1179101497 21:38358967-38358989 TGGCAGACGGAAGGTGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1180133251 21:45841956-45841978 TGACAAAGGGCAGTGATTGAAGG - Intronic
1182011488 22:27004521-27004543 TGGCAAAGGGCAGAGGTACATGG - Intergenic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950111879 3:10423886-10423908 GTGCAAAGGGCAGTGGTGGTGGG + Intronic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952511964 3:34067197-34067219 TGCCAAAAGCCTGTGGTGGAAGG - Intergenic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953390030 3:42528501-42528523 TGGCAGATGGCAGAGTTGGAAGG - Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953866042 3:46584416-46584438 TGGGAAAAGGCCGAGGTGGATGG + Intronic
954138011 3:48591122-48591144 TGGCAGAGGTCAGTGCTGGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955808042 3:62757296-62757318 TGGCAGATGGCAGCTGTGGAAGG - Intronic
956884241 3:73542924-73542946 TGGCAAACTCCAGTTATGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960962987 3:123085016-123085038 TGGCAGAAGGCAGTGGGGGCAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964696711 3:159516290-159516312 TGGCCAAAGGGAGTGGAGGAAGG - Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969446236 4:7246276-7246298 TGCCAAAGGGCACAGGTGGATGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973673498 4:53240778-53240800 TGCCACAGGGCAGTGGTCGATGG + Intronic
974019603 4:56681137-56681159 TGGAAAACGGTAGAGGTGAAAGG - Intronic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974990298 4:69078869-69078891 TGACAAGTGGCAGTGGTGGGTGG + Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977838425 4:101672276-101672298 TGGCAAATGGCAGTGATAGGAGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982225912 4:153166446-153166468 TCCCAAAAGGCAGTGCTGGAAGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
986022571 5:3818728-3818750 TGGCAAAGGACAGTGGTGAGTGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986634797 5:9810757-9810779 TGGCAAAGGGCATTGCTTGAGGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988606654 5:32684474-32684496 TGGCACAGGGCAGTGGTGCTGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
1000306704 5:160001332-160001354 TGGATAACTGGAGTGGTGGAGGG + Intergenic
1002283680 5:178148355-178148377 TGGCTGAGGGCAGGGGTGGAAGG - Exonic
1003426447 6:6001212-6001234 GGGCAAAGGGGACTGGTGGAAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005362146 6:25041012-25041034 TAGCAATAGGCAGTGGTAGAGGG - Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007173255 6:39879261-39879283 AGGCAAAGGGCAGAGGAGGAGGG - Exonic
1007254619 6:40520247-40520269 TGGCGTACGGCAGTGATGAAGGG + Intronic
1007739952 6:44004190-44004212 TGACAAAAGGGAGTGCTGGAGGG - Exonic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009978002 6:70693726-70693748 TGGAAAATGGCATTGGGGGAAGG + Intronic
1011112465 6:83853596-83853618 TGGCACCGGGCAGTGGGGGATGG - Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012446747 6:99314717-99314739 TGGCATGAGGCAGTGGTGGCAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016108533 6:140192007-140192029 TGGCTAATAGCAGTTGTGGAGGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021027478 7:15686857-15686879 TGGCAGCCGGCAGTGCTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG + Intronic
1022839326 7:34147999-34148021 TGGCAAACGGAAGCCTTGGAAGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023019109 7:35994552-35994574 TGGTAAATGGTAGTGGGGGAGGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024528933 7:50374439-50374461 TGGCAAGTGGCAGAGCTGGAAGG - Intronic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028361478 7:89972171-89972193 TGAGAAAAGGCAGTTGTGGAGGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030071960 7:105705618-105705640 TGGCAAGTGGCAGGGGTGCATGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1034985512 7:155511130-155511152 TGGGAAACGAGAGTGGGGGAGGG - Intronic
1035664994 8:1374202-1374224 TTGCAGAAGGCTGTGGTGGAGGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040089678 8:43385042-43385064 TGGCAAATGGCAGTTATGGGGGG - Intergenic
1040402407 8:47064617-47064639 TGGCAAATGGCAGTTATGGGGGG + Intergenic
1040790840 8:51228035-51228057 TGGCAAACGGGGTTGGGGGAGGG + Intergenic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042674064 8:71299103-71299125 TGGTAAGTGGCATTGGTGGATGG + Exonic
1043484194 8:80682714-80682736 TGCCAAACGGCGGTGGGGGAGGG + Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047880631 8:129188994-129189016 TGGCAAAGGGCAGTGAAGAAAGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051909644 9:22138668-22138690 TGGCAAATGACAGTGGAGCAGGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1060803366 9:126558484-126558506 TGGGGAATGGCACTGGTGGACGG + Intergenic
1061089094 9:128416701-128416723 TGGCTGAGGGCAGAGGTGGAAGG + Intronic
1061900485 9:133669681-133669703 AGTCACACGGCAGAGGTGGAAGG - Intronic
1062639915 9:137513947-137513969 TGGCAGACGGCAGAGGGGGCAGG + Intronic
1186317534 X:8386958-8386980 TGGCAAAAGAAAGGGGTGGAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1190625754 X:52336948-52336970 TGGCAAAGGGCAGTGGAGCCTGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192282216 X:69699064-69699086 TAGGAAAAGGCAGTGGCGGAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193010473 X:76669818-76669840 TAGCAAACTGCAGTACTGGAGGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194771319 X:97909264-97909286 TGGGAAACGGTACAGGTGGATGG + Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197521983 X:127510242-127510264 TGTGAAATGTCAGTGGTGGATGG + Intergenic
1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200240889 X:154492980-154493002 TGGAAAACGGCAGTGAGGGTAGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic