ID: 1005819470

View in Genome Browser
Species Human (GRCh38)
Location 6:29585770-29585792
Sequence TAGGAGAAAAATAATGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 707}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005819466_1005819470 9 Left 1005819466 6:29585738-29585760 CCAATGCATGAATATTTCAGAAG 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG 0: 1
1: 0
2: 4
3: 60
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005819470 Original CRISPR TAGGAGAAAAATAATGAGAG TGG Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
901074685 1:6546424-6546446 AAGGAGAGAAGAAATGAGAGTGG - Intronic
901108637 1:6777489-6777511 TTGAAGAAAAATAATGTGAAAGG - Intergenic
902122841 1:14182448-14182470 TAGAAGAAAACCAATCAGAGTGG - Intergenic
902463414 1:16597644-16597666 TACGGTAAAAATAATTAGAGAGG - Intronic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
902844433 1:19098699-19098721 TGGGAGAAAAGAAAGGAGAGAGG + Intronic
903476905 1:23625832-23625854 TAAAATGAAAATAATGAGAGTGG + Intronic
904509249 1:30989129-30989151 TTGAAGAAAAATAACTAGAGAGG - Intronic
904887414 1:33751286-33751308 TAGGAGAAAACACAGGAGAGTGG + Intronic
905083943 1:35352706-35352728 TAGGAGAAAAATGAGGAGACTGG - Intronic
906053627 1:42896313-42896335 TTGAAGAGAAATAGTGAGAGTGG + Intergenic
906390315 1:45409725-45409747 TAAGAGAAAGATAATAAGAATGG + Intronic
906981591 1:50636755-50636777 TAGGAAAAAATTTCTGAGAGAGG - Intronic
906981681 1:50637806-50637828 TAGGAAAAAATTTCTGAGAGAGG - Intronic
907139189 1:52169435-52169457 AAGATGAAAAATAAAGAGAGAGG - Intronic
908884098 1:68767781-68767803 TAGGAAAAAAATACTGTCAGGGG - Intergenic
909111733 1:71487424-71487446 TGGGACCAAAATAATCAGAGGGG - Intronic
909796324 1:79741663-79741685 TACCAGGAAAATAATGAGAGGGG - Intergenic
910103818 1:83608692-83608714 TTGGAGAAAAAAATTAAGAGCGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910566525 1:88649678-88649700 TTGGAAAAAAATAAAGACAGTGG + Intergenic
910638317 1:89433561-89433583 GAGCAGAAAAATAAAAAGAGCGG - Intergenic
910893652 1:92044202-92044224 TAGGGGAAAAAAAATGAATGGGG + Intronic
910936660 1:92488573-92488595 TAGGAGAAAGGTAAGAAGAGGGG + Intergenic
910941922 1:92545796-92545818 TAGGAGGAAAATGAGTAGAGAGG - Intronic
911801019 1:102138084-102138106 TAGCATAAAAATAAAGACAGGGG - Intergenic
913677307 1:121152979-121153001 AAGGAAAAAAATGATCAGAGGGG - Intergenic
914029144 1:143940608-143940630 AAGGAAAAAAATGATCAGAGGGG - Intergenic
914160307 1:145127342-145127364 AAGGAAAAAAATGATCAGAGGGG + Intergenic
915156592 1:153881746-153881768 AAGGAGGAAAATAATGAGATGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
915863206 1:159469793-159469815 AAGGAGAAAAAGAAAGAAAGGGG + Intergenic
915993828 1:160544533-160544555 CAGAAGAAAAATAATGAGTCTGG + Intronic
916450365 1:164914981-164915003 TTGGAGAACTATAAGGAGAGGGG + Intergenic
916598102 1:166265520-166265542 TAAGTGAAAAATAATCAGACTGG - Intergenic
917378333 1:174375766-174375788 TAAGAAAAAAATAATAAGACTGG + Intronic
917663835 1:177204481-177204503 AAGCAGAAAAAAAAAGAGAGTGG + Intronic
917797198 1:178541204-178541226 TGGAAGAAAAAGAATGACAGTGG - Intronic
918278285 1:182976398-182976420 TAGCACAAGAAAAATGAGAGAGG + Intergenic
918585236 1:186179594-186179616 TAGGAGAGAAGTAAAGAGGGAGG + Intronic
918657964 1:187052857-187052879 GAGGAGAAAAAGAATGGGATGGG - Intergenic
918658055 1:187053771-187053793 TTGGAGAATAAACATGAGAGGGG + Intergenic
918669174 1:187192554-187192576 TAATAGAGAAAGAATGAGAGAGG + Intergenic
918689510 1:187463494-187463516 TATGAGAAAAATCATAAGTGTGG + Intergenic
918695204 1:187537596-187537618 TAGGGGAAAAATTATGACATTGG - Intergenic
919343630 1:196346580-196346602 AAGGTCAATAATAATGAGAGGGG - Intronic
919345763 1:196376173-196376195 TGGGAAAAAAAGAAAGAGAGGGG - Intronic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
919617890 1:199830254-199830276 GAGGAGAGAAAAAAGGAGAGAGG - Intergenic
919869974 1:201812856-201812878 TGGGAAAAAAACAAGGAGAGGGG - Intronic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920464611 1:206171495-206171517 AAGGAAAAAAATGATCAGAGGGG - Intergenic
920606196 1:207389472-207389494 TATGATAAAATAAATGAGAGAGG - Intergenic
920908769 1:210194652-210194674 TAGCAGAAAAGTCATTAGAGAGG - Intergenic
921568612 1:216751511-216751533 CAGGAGAGAAATGATGAAAGGGG - Intronic
921618348 1:217298368-217298390 TAGGAAGAAAATAGAGAGAGAGG + Intergenic
921839431 1:219812563-219812585 GAGGAGAAAAAGATTCAGAGAGG + Intronic
922055414 1:222037855-222037877 TGGGAGGAAAATCAAGAGAGTGG + Intergenic
922071225 1:222195495-222195517 TAGTAGAAAAATAGAGAGATGGG - Intergenic
922149162 1:222982403-222982425 TAGGAAAAAAATAATCTGATAGG + Intronic
922392872 1:225164795-225164817 TAGCATCAACATAATGAGAGTGG - Intronic
922974318 1:229771020-229771042 TAGGAGAAAACAATTGAGGGAGG + Intergenic
923647336 1:235837246-235837268 CAGGAGAAAAATCAGGTGAGTGG + Intronic
923814140 1:237356708-237356730 TAGGAAAAAATAAAGGAGAGAGG + Intronic
924754616 1:246930526-246930548 TAGGAGAGAAGAAATTAGAGTGG - Intronic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
924870329 1:248035791-248035813 TGGGAGAAAGGTAATGAGTGTGG - Intronic
924918193 1:248596446-248596468 CAGGAGAACAAAAGTGAGAGTGG + Intergenic
1063116669 10:3076557-3076579 AAGGAGAAAAATAACAAGCGGGG - Intronic
1063185588 10:3647874-3647896 TAGGAGATTGATGATGAGAGAGG - Intergenic
1063307448 10:4918270-4918292 AAAGAGAAAAAAAGTGAGAGGGG + Intergenic
1063694695 10:8322438-8322460 TAGAATAAAAATAATGAGCTTGG - Intergenic
1063889313 10:10613401-10613423 TGGGAGAAAAATAAACACAGTGG + Intergenic
1064631596 10:17319516-17319538 TAGGAGAAAAAGAATGTTTGCGG - Intronic
1065092027 10:22244830-22244852 TTGGAGAGAAAGAAAGAGAGAGG - Intergenic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1066025623 10:31356762-31356784 TAGGGAAATAATAATGAGACTGG + Intronic
1066247428 10:33596889-33596911 TATGACAAAAATAATAAAAGTGG - Intergenic
1067740165 10:48889491-48889513 TGGGAGAAAAAAAATAAAAGAGG - Intronic
1068374502 10:56160954-56160976 TAGAAAATAAACAATGAGAGGGG + Intergenic
1068389570 10:56377021-56377043 TAAGAGAAAAAGACAGAGAGAGG - Intergenic
1068765324 10:60756775-60756797 TAAGAGAAAAACGATAAGAGAGG + Intergenic
1068847489 10:61694791-61694813 TAGGAGAACAAAAATTGGAGGGG + Intronic
1068877275 10:62010169-62010191 TATGAGAAAGAAAAGGAGAGAGG + Intronic
1068890890 10:62147446-62147468 TAGGAGAAAAAAAAAAGGAGAGG - Intergenic
1069108451 10:64412470-64412492 TAGGAAAAAAATAAGCACAGTGG + Intergenic
1069169987 10:65214743-65214765 AAGCAGAAAAAAGATGAGAGTGG + Intergenic
1069218423 10:65852304-65852326 TAGAAAAAAAGAAATGAGAGAGG + Intergenic
1070116645 10:73535142-73535164 TAGGAGAAAGATTATGGGATAGG - Intronic
1070225201 10:74496969-74496991 AAAGAGAAAAAAAATGAGAGAGG - Intronic
1070535270 10:77372483-77372505 GAAGAGAAAAAGATTGAGAGAGG - Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070972577 10:80579690-80579712 AAGGAGAAAAAAAAAGGGAGTGG - Intronic
1071060246 10:81561527-81561549 GAGTAAAGAAATAATGAGAGAGG - Intergenic
1071558640 10:86627675-86627697 TTGAAGGAAAAGAATGAGAGAGG - Intergenic
1072973247 10:100035925-100035947 AAGAAGAAAAATAGTGAAAGAGG + Intergenic
1073677044 10:105659821-105659843 TATGGGAAAAAAAGTGAGAGTGG - Intergenic
1073998856 10:109346823-109346845 TATTAGAAAAACAATGAGAATGG - Intergenic
1074617931 10:115088998-115089020 TAGGATAAAAATAAGGGGAATGG - Intergenic
1074781407 10:116804790-116804812 TGGGAGAAAAATAATGATTGTGG + Intergenic
1074939898 10:118224387-118224409 TAGGAGGAAAACAATGCTAGTGG + Intergenic
1077980735 11:7298286-7298308 TAGAAGTAAAATAATGTGATTGG - Intronic
1078360381 11:10663276-10663298 TAGGAGGAACTGAATGAGAGAGG - Intronic
1078569780 11:12447644-12447666 TAGTAGAAAAAAACTGGGAGAGG + Intronic
1079441756 11:20522173-20522195 TTGTATAAAAATAATGACAGTGG + Intergenic
1079551477 11:21704243-21704265 AAGGACAAACATAAGGAGAGGGG - Intergenic
1079569096 11:21920921-21920943 AAGGAGAAAAATTTTGAGAAGGG - Intergenic
1079611148 11:22433992-22434014 AAGAAGAAAATTAATGAGAAGGG + Intergenic
1079717162 11:23763067-23763089 TAAGAGAAAGAGAGTGAGAGAGG - Intergenic
1079908640 11:26281395-26281417 TATGACTAAAATAATGAGATAGG + Intergenic
1080007899 11:27429133-27429155 GAGGAGAAAAATAAAGAAAATGG + Intronic
1080686230 11:34517343-34517365 TATGAGAATAATAGTGACAGGGG - Intergenic
1082016706 11:47494280-47494302 TAGTAGAAACATAAAAAGAGAGG - Intronic
1082207166 11:49451675-49451697 TAGGAGAATAAGAATTAGAAAGG - Intergenic
1082700778 11:56427570-56427592 TGGGAAAAAAATACTTAGAGTGG + Intergenic
1083134489 11:60659084-60659106 TTGAAGAATAATAAAGAGAGTGG + Intergenic
1083988369 11:66231758-66231780 GGGGAGAGAAATAATGAGAGTGG - Intronic
1085753313 11:79182143-79182165 TTGGAGAAGAATAAAGACAGAGG + Intronic
1085755602 11:79198854-79198876 TAGGAGAAAGATTAAAAGAGGGG + Intronic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086088962 11:82985629-82985651 AGAGAGAAAAAAAATGAGAGTGG + Intronic
1086319708 11:85632101-85632123 TAGGAGAAAACCATTGAGGGGGG + Intronic
1086648110 11:89250061-89250083 TAGGAGAATAAGAATTAGAAAGG + Intronic
1086685263 11:89726876-89726898 TTGGAAACAAATAATGAAAGTGG + Intergenic
1086824092 11:91474156-91474178 TAACAGAGAAATAATGATAGAGG + Intergenic
1087444592 11:98234076-98234098 TGAGAGAAAAAGAATGAGAGAGG - Intergenic
1087982580 11:104634361-104634383 TAGAAGGAAAAGAATGAGAAAGG + Intergenic
1088220941 11:107569736-107569758 TAGGAGTAACATATTGAAAGGGG + Intergenic
1088297286 11:108313584-108313606 AAGGAGAAAAATCAGGAGAGTGG - Intronic
1088315873 11:108505956-108505978 TAGGAGTAAATTATTTAGAGGGG + Exonic
1088943460 11:114484403-114484425 GAGGAGAAAGAAAAAGAGAGAGG - Intergenic
1089295923 11:117468079-117468101 AAGGAGAGAAAAAAAGAGAGAGG - Intronic
1089905090 11:122030327-122030349 TATGAAAAACATAATAAGAGGGG + Intergenic
1089923615 11:122233844-122233866 TAGGGGAAACATACTGGGAGAGG - Intergenic
1090346276 11:126073986-126074008 GATGAGAAAAATAATAATAGTGG - Intergenic
1090898848 11:131006970-131006992 TAGGAGAAAAATGAAGAACGAGG - Intergenic
1091518545 12:1212058-1212080 AAAGGGAAACATAATGAGAGTGG - Intronic
1092033720 12:5311965-5311987 TAGGAGAAAAAGAGTGTGAATGG - Intergenic
1092147001 12:6221655-6221677 TAGGAGAAACTAAATGGGAGGGG - Intronic
1093071731 12:14712882-14712904 TAACAGAAAAATAATGTGTGTGG - Intergenic
1093211947 12:16318292-16318314 TAGAAAAAAATCAATGAGAGAGG - Intergenic
1093265054 12:16992814-16992836 TAGTAGAAATATGGTGAGAGAGG - Intergenic
1093371546 12:18372405-18372427 TAGGAGATAAAGAATGAAATAGG + Intronic
1093739819 12:22671872-22671894 TAGGAGAAAAATAATGATTGTGG + Intronic
1094246292 12:28298633-28298655 TAGAAGAAAAATTATGAAATTGG - Intronic
1094551623 12:31457257-31457279 TAGGATAGAGAGAATGAGAGTGG - Intronic
1095513265 12:42976918-42976940 TAGGAGAAAAAAAAAAAGTGGGG - Intergenic
1096008194 12:48189146-48189168 TAGGAGCTAAATCCTGAGAGAGG - Intergenic
1096089930 12:48892290-48892312 AAGGAGAAAGAGAAAGAGAGAGG - Intergenic
1097006910 12:55926648-55926670 TTCGAGAAAAATAATGAAAACGG + Intronic
1097292792 12:57933174-57933196 TAAGAGAAACATCAGGAGAGTGG - Intergenic
1097367411 12:58732375-58732397 TGAGAGAAAGATAATGGGAGTGG - Intronic
1097560164 12:61194198-61194220 TGGGATAAAAATAATGAAATTGG - Intergenic
1097608371 12:61784197-61784219 AGGGAGCTAAATAATGAGAGAGG + Intronic
1097609327 12:61799375-61799397 TTTGATAAAAATGATGAGAGGGG + Intronic
1097905328 12:64913626-64913648 TAGGAAAAACAGAATGACAGAGG - Intergenic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1098696494 12:73563778-73563800 TTGGAGAAAAATAATGTAAATGG - Intergenic
1098705343 12:73681329-73681351 AAGAAGAAAAAAAATGAGATGGG - Intergenic
1099028190 12:77491987-77492009 AAGGAGAAAAAATATGAGATAGG - Intergenic
1099196451 12:79622207-79622229 TAGGAGGAACATACTGAAAGGGG + Intronic
1099520693 12:83657498-83657520 TAGGATTAAAATATTGAAAGAGG + Intergenic
1099667529 12:85651567-85651589 TAGGATCAAAATAAAGAGATGGG - Intergenic
1099896840 12:88659042-88659064 TAGGAAATAAAAAATGAGAAGGG - Intergenic
1100591151 12:96030697-96030719 AAGGAAAAAAATAATGCCAGAGG - Intronic
1100882855 12:99037837-99037859 TAGGAGAAAAATGATGGTACAGG - Intronic
1100935710 12:99662795-99662817 AAGGAGAAAAATATTGATAGGGG - Intronic
1101037595 12:100720547-100720569 TAGGAGGAAAATGAGGGGAGAGG - Intronic
1101310852 12:103577072-103577094 AAAGAGTAAAAAAATGAGAGAGG - Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101915221 12:108890622-108890644 GAGAAGAAAAAAAAAGAGAGAGG - Intronic
1103133613 12:118489064-118489086 TTGGAGAATAAAACTGAGAGGGG + Intergenic
1104616592 12:130275436-130275458 AAGGAGAAAAACAAAGTGAGAGG - Intergenic
1104660165 12:130606321-130606343 TGGTAGAATAATAGTGAGAGGGG - Intronic
1104803721 12:131571796-131571818 TGGGAGAAAGAAAAAGAGAGAGG - Intergenic
1105532614 13:21233309-21233331 TAGGACTAAGAGAATGAGAGGGG - Intergenic
1105628290 13:22135424-22135446 TAAAAGAAAAATTATGAGAAAGG + Intergenic
1106359968 13:29021962-29021984 AAGGAGAAAAAGCATGAGAGCGG + Intronic
1107844006 13:44491794-44491816 TAGGAAAACAATAATCAGTGGGG + Intronic
1109786059 13:67176390-67176412 GAGGAGATAAATGAAGAGAGTGG - Intronic
1110210730 13:72969041-72969063 AAAAATAAAAATAATGAGAGTGG + Intronic
1110718859 13:78738928-78738950 GAGGATAATAATAATCAGAGTGG + Intergenic
1110819329 13:79896376-79896398 CAGGAGAAAGAGAGTGAGAGGGG + Intergenic
1110852200 13:80258646-80258668 CAGGAGAAAAAGAGGGAGAGTGG + Intergenic
1111217718 13:85165564-85165586 TAGGAGAAAAACAGAGAGAAGGG - Intergenic
1111279174 13:85996355-85996377 TTTGAGAAAAATAAACAGAGAGG - Intergenic
1111434504 13:88189098-88189120 TTGCAGTAAAAAAATGAGAGTGG + Intergenic
1111810795 13:93093695-93093717 TAGGAACAAAATAATGGGGGGGG - Intergenic
1112095377 13:96126862-96126884 AAGGAGAAGACTAAAGAGAGAGG - Intronic
1112101413 13:96193660-96193682 GAGGAGAAAAAGAAAGCGAGAGG + Intronic
1112635991 13:101218710-101218732 CAGGAGGAAAAGAAAGAGAGAGG - Intronic
1112743591 13:102502776-102502798 TAGAAAAAAGATAATGGGAGTGG + Intergenic
1112824055 13:103371387-103371409 TGGGAGGAAAAGAATGAGATTGG + Intergenic
1113096392 13:106668506-106668528 TTGGAGGAAATTAATGAGACAGG - Intergenic
1113195525 13:107799960-107799982 AAAGAAAAAAATATTGAGAGAGG + Intronic
1113330791 13:109325214-109325236 GAGGAGAGATATAAAGAGAGAGG - Intergenic
1114510411 14:23254806-23254828 TAACTGAAAAATACTGAGAGAGG - Intronic
1115202425 14:30869061-30869083 TAGGTGAAAAATAAGGAAATCGG + Intergenic
1115297513 14:31845841-31845863 TTGGAGAAAAATAAGAAGGGAGG - Intronic
1115316010 14:32025935-32025957 GAAGAGAAAAATCATAAGAGAGG + Intergenic
1115664418 14:35532929-35532951 TTGGAGAAAAAGACTGACAGAGG - Intergenic
1115946720 14:38669940-38669962 AAGGAGAAAACTCATGACAGAGG - Intergenic
1116047688 14:39764461-39764483 TAAGAAAAAAATGTTGAGAGTGG + Intergenic
1117190389 14:53284678-53284700 AAGGACAAAAGTAATGAGGGTGG + Intergenic
1117206614 14:53450021-53450043 CAGGAAAGAAATGATGAGAGAGG + Intergenic
1117450066 14:55841421-55841443 TTGGAGAAAGATGATAAGAGAGG - Intergenic
1117521411 14:56555004-56555026 TAGGATAAAAATAAAAAGCGAGG + Intronic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1118191439 14:63584253-63584275 TAGGAAGGAAATAATCAGAGTGG + Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119121046 14:72077963-72077985 TGGGAGAAAAATACTGGTAGAGG - Intronic
1119230607 14:72976482-72976504 GAGGAGAAAAATAAGGAAATCGG + Intronic
1119371264 14:74146105-74146127 TTGGGAAAAAATAATGAAAGGGG - Intronic
1120103189 14:80467194-80467216 TAGGGGAAGAATAATAACAGTGG - Intergenic
1120143548 14:80955319-80955341 TTGGAGAGAACTAATGGGAGGGG + Intronic
1120806017 14:88751768-88751790 AAAGATAAAAATAATCAGAGAGG + Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1123775702 15:23577788-23577810 TAGGAGAAAAATAATAAATGTGG + Intronic
1124642837 15:31407370-31407392 TACGAGAAAGATAAGGGGAGGGG + Intronic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124932253 15:34132203-34132225 TGGGAGAAAAATAAAGGGTGAGG + Intergenic
1124986147 15:34617505-34617527 TAGGATGAAAATGCTGAGAGAGG - Intergenic
1125815714 15:42582175-42582197 TAGGAGAAACACAGTGAGACAGG - Intronic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126727035 15:51642299-51642321 TATGACAAAAATAATGACAATGG + Intergenic
1126739880 15:51766835-51766857 TAGGGGAAAAAGAAGGAAAGAGG + Intronic
1126888003 15:53173163-53173185 GAGCAGAAAAATAATTAGACTGG + Intergenic
1126966833 15:54063544-54063566 TAGGAGAATAAAAATGAGTGAGG - Intronic
1127013541 15:54656845-54656867 TAAGAGTACAATAATGAGAAAGG - Intergenic
1127067934 15:55259699-55259721 TAAGGGAAAAATAATGAAATTGG - Intronic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1128423077 15:67513170-67513192 TAGCAGAGAAAGAATGAGATGGG + Intergenic
1129335265 15:74848400-74848422 AAGGAGAAAAAAAAAGTGAGTGG + Intronic
1129650982 15:77489419-77489441 TTAGAGATAACTAATGAGAGTGG + Intergenic
1129770865 15:78202603-78202625 TAGGAGAAACCTAGGGAGAGAGG - Intronic
1129798123 15:78393446-78393468 TTGGAGAAAAATAATGGAAGTGG - Intergenic
1129957985 15:79656608-79656630 TAGGAGTGAAATAATGGGATTGG - Intergenic
1130091597 15:80825646-80825668 GAGGAGAACAAAAGTGAGAGAGG + Intronic
1130744604 15:86637664-86637686 TAGGACAAAAGCAATGAGGGTGG + Intronic
1133503408 16:6386933-6386955 TGGTTGAAAAATAAAGAGAGAGG + Intronic
1134472850 16:14542714-14542736 TAGCAGAAAAATGATGTCAGAGG + Intronic
1134654480 16:15937720-15937742 TTTGAGAAAATGAATGAGAGAGG - Intergenic
1134816802 16:17212578-17212600 TGGGAGAAAAATAATGAATGAGG - Intronic
1135012140 16:18891400-18891422 CAGGAGAAAATTAATGAAAATGG - Intronic
1135318996 16:21478624-21478646 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135371894 16:21910417-21910439 CAGGAGAAAATTAATGAAAATGG - Intergenic
1135439894 16:22460287-22460309 CAGGAGAAAATTAATGAAAATGG + Intergenic
1135939345 16:26807401-26807423 TTGGAGAAATATAAAGACAGAGG + Intergenic
1136329301 16:29560694-29560716 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136357988 16:29759088-29759110 AAGGAGAAAGAGAGTGAGAGAGG + Intergenic
1136443930 16:30300405-30300427 CAGGAGAAAATTAATGAAAATGG - Intergenic
1136931120 16:34418718-34418740 TGGGAGAACAAAAATGGGAGAGG - Intergenic
1136973453 16:34993090-34993112 TGGGAGAACAAAAATGGGAGAGG + Intergenic
1137002643 16:35243379-35243401 TTTGAAAAAAATAATTAGAGTGG - Intergenic
1137742255 16:50790442-50790464 CAGGAAAAAAAAAATAAGAGAGG - Intronic
1137843979 16:51668987-51669009 AAGGAGAAAAAGAGAGAGAGAGG + Intergenic
1138101977 16:54259423-54259445 TATGACAGAAATAATGAGATTGG + Intronic
1138698298 16:58836249-58836271 TAGGAGGAAAAACAGGAGAGTGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139031015 16:62880627-62880649 TTGCAGAAAAATTGTGAGAGTGG + Intergenic
1139203361 16:65002121-65002143 TAGGGGAAAAATAAATAAAGTGG - Intronic
1139341605 16:66271203-66271225 GGGGAGAAAAGGAATGAGAGGGG + Intergenic
1140121817 16:72090267-72090289 TAGGAAAAAAAAAACCAGAGAGG - Intronic
1140171455 16:72609179-72609201 TAGGGGTAAAATCATGAGAATGG + Intergenic
1140235856 16:73158007-73158029 CAGGAAAAAAAAAATGAGACAGG + Intergenic
1141931886 16:87210740-87210762 GAGGAGAAAGAAAAAGAGAGAGG + Intronic
1144017110 17:11206870-11206892 TTAGAGGAAATTAATGAGAGAGG - Intergenic
1144076074 17:11720455-11720477 TATAACAAAAATAACGAGAGAGG - Intronic
1145720145 17:27063581-27063603 GAGGAGAATAATAATGGCAGAGG - Intergenic
1145982714 17:29023330-29023352 TTGGGGAAGAATAATGAGATTGG + Intronic
1146141082 17:30368465-30368487 ATGGAGAAAAATACTGAAAGAGG - Intergenic
1146637079 17:34514478-34514500 TAAGAGAGTAAGAATGAGAGAGG - Intergenic
1146704365 17:34989900-34989922 TAGGAGCAGAATAAGGGGAGAGG - Intronic
1146918934 17:36696888-36696910 AAGGAGAAAACTGAAGAGAGGGG + Intergenic
1147054313 17:37822671-37822693 GAGGAAAGAAAGAATGAGAGAGG - Intergenic
1147305709 17:39562835-39562857 AAGGAGGAAAAAAATGAGAGAGG - Intronic
1147908344 17:43838394-43838416 TATGGGAAAAAAAAAGAGAGAGG + Intergenic
1148203974 17:45768115-45768137 GAGGAGAAAAGTGATGAGACTGG - Intergenic
1148508818 17:48150576-48150598 TAGGAAATAAATAATGAAAATGG - Intronic
1149340505 17:55681226-55681248 TAGGAGACAAGGAAAGAGAGAGG + Intergenic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1150333862 17:64316019-64316041 AAGCAGAGAAAGAATGAGAGAGG + Intergenic
1150470617 17:65434250-65434272 TTTGAGAAAGATAATGAAAGAGG + Intergenic
1150911314 17:69390418-69390440 TTGGAGAAAAGAAAGGAGAGGGG - Intergenic
1151130095 17:71887988-71888010 TAGGATAAAAATATAGAAAGAGG - Intergenic
1152452838 17:80393864-80393886 TAGAAGAAAAAAAAAAAGAGGGG - Exonic
1153581857 18:6582023-6582045 TTGGAGAAAGATGTTGAGAGTGG + Intronic
1153713508 18:7823080-7823102 TAGGAGAAACATTAGGACAGTGG - Intronic
1155102319 18:22623820-22623842 AAGCAGAAAAATAATTAAAGAGG + Intergenic
1155482150 18:26300849-26300871 AAGGAAAAAAAAAATCAGAGTGG - Intronic
1155730943 18:29157449-29157471 TAAGAAAAAAATAAAGAGAAAGG + Intergenic
1156034432 18:32750967-32750989 TAGGAGAAAAAAAGAGAGAAAGG - Intronic
1156588422 18:38458964-38458986 GGGGAGAAAAAAAAAGAGAGTGG + Intergenic
1158049338 18:53197054-53197076 CAGGAGAAAAAAAATCAAAGAGG + Intronic
1158237671 18:55337466-55337488 TGGGAGGAAAATCTTGAGAGAGG + Intronic
1158313772 18:56188357-56188379 GGGTAGAAGAATAATGAGAGTGG + Intergenic
1158426539 18:57345117-57345139 TAGGAGAAAGATACTCAGGGAGG - Intergenic
1158750862 18:60258845-60258867 TCTGACAAAAATAATGAGGGAGG - Intergenic
1158907620 18:62029276-62029298 TATGAGAAAAAAGAAGAGAGAGG - Intergenic
1158975277 18:62705383-62705405 TAGGAGAAAAAAAATCTGGGAGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159466777 18:68794090-68794112 TAGGAGAAACCTGATGACAGTGG + Intronic
1159467592 18:68804571-68804593 TAGGAGGAGAACCATGAGAGAGG + Intronic
1160384544 18:78487025-78487047 TGGGAGAACATTAATGAGGGAGG + Intergenic
1163119849 19:15210865-15210887 AAAGAAAAAAATAAAGAGAGCGG - Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1167387473 19:49172219-49172241 AAGGGGAAAAATATTAAGAGGGG - Intronic
1167761677 19:51453873-51453895 AATAGGAAAAATAATGAGAGGGG + Intronic
1168151491 19:54451266-54451288 TATGAGAAAAAGAATGAGTTAGG - Intronic
1168520406 19:57045865-57045887 TGGAAGAAAAATACTGAGAAAGG - Intergenic
1168532026 19:57137793-57137815 AAGGAGATAAAGAAAGAGAGAGG + Intronic
1202679076 1_KI270711v1_random:35091-35113 TACGGTAAAAATAATTAGAGAGG - Intergenic
925281011 2:2684696-2684718 TGGGAGAAAAAACATGAGAATGG - Intergenic
926231892 2:11010585-11010607 TAGAGGAAAAATAATGGAAGGGG + Intergenic
926340047 2:11897952-11897974 CAGGAGAAAAAAAATCAGTGAGG + Intergenic
926509913 2:13762077-13762099 CATGAGAAAAAAAATGAAAGAGG + Intergenic
926770861 2:16373908-16373930 GAGGAGAAAAAAAGGGAGAGGGG - Intergenic
926993379 2:18705228-18705250 TAGGAGAGAAAAAATGGTAGAGG + Intergenic
927182693 2:20458286-20458308 TAGAAAAAAAAAAATTAGAGGGG + Intergenic
927424456 2:22966351-22966373 TAGGAGTAAAAAAAAGATAGGGG - Intergenic
927872210 2:26630839-26630861 TAGGAGAGAAACACAGAGAGAGG - Intronic
928383377 2:30840735-30840757 TAAGAGAAAGATGATGAGATTGG + Intergenic
928770380 2:34697483-34697505 TAGGAGAGAAGTCATTAGAGAGG + Intergenic
928778750 2:34795024-34795046 TAGCAGAGAAATCATTAGAGAGG - Intergenic
928794728 2:35004323-35004345 AAGGGGAGAAATAATGAGAAAGG - Intergenic
929408517 2:41670233-41670255 AAGGAGAAAAACAATTAGAGAGG - Intergenic
929457793 2:42078287-42078309 TAGGAGAAACATCTTGAGTGTGG + Intergenic
929681657 2:43998100-43998122 AAGGAGAAAAAAAAAAAGAGTGG + Intergenic
930098287 2:47583799-47583821 TAGCAGAAAAGTCATTAGAGAGG + Intergenic
930226662 2:48800985-48801007 AAGAAGAAAAATAAGGAAAGAGG - Intergenic
930851358 2:55964572-55964594 TAGGAAACAGATAGTGAGAGAGG - Intergenic
931508493 2:62960268-62960290 TAGAATGAAAAAAATGAGAGAGG - Intronic
931674770 2:64683366-64683388 TTGGAGAAAAAGAAAGAGATAGG + Intronic
931761582 2:65422140-65422162 TATGAGAGAAAGAATGAGTGAGG - Intronic
932067621 2:68583156-68583178 TAGGAAAAAACTGATGAGATGGG - Intronic
932095759 2:68846985-68847007 TAGGATAAAAATGAAGAGACTGG + Intergenic
932878404 2:75476499-75476521 AAGGAGAAAAATGAAGAGAATGG - Intronic
933253609 2:80056199-80056221 AAAGAGAAAAAGCATGAGAGAGG + Intronic
933314559 2:80700514-80700536 CTGGAGAAAAATGATGAAAGAGG - Intergenic
933427972 2:82137409-82137431 CAATAGAATAATAATGAGAGGGG + Intergenic
933505350 2:83170328-83170350 TAGGAAAAAAAGAAGGAGAAGGG - Intergenic
933520487 2:83365874-83365896 CAGGATAAGAATAATAAGAGTGG + Intergenic
933571360 2:84017109-84017131 TACTAGAAAAATCAGGAGAGTGG - Intergenic
934883231 2:98001692-98001714 CAGGAGAGAAAAAATCAGAGTGG - Intergenic
935283673 2:101544426-101544448 TAGAAGTAAAATAATGGGAAAGG - Intergenic
938132460 2:128728726-128728748 TAAGAGAAAGATAATTTGAGAGG + Intergenic
939115841 2:138059485-138059507 TAGGAGAAAAAAATGGAGATAGG - Intergenic
939200999 2:139033787-139033809 TAGGAAAACCATATTGAGAGCGG - Intergenic
939691321 2:145265208-145265230 TAGTAGGAGAAAAATGAGAGGGG - Intergenic
939758558 2:146145071-146145093 TAGGAAAAAAAGAGGGAGAGGGG + Intergenic
940004751 2:149000145-149000167 CAGGGGAAAAATAATGAGATGGG - Intronic
940029489 2:149246397-149246419 TAGGAAAAACATAATGAATGTGG + Intergenic
940459773 2:153949657-153949679 AAGGAGAAAAATACAGAGTGGGG + Intronic
940519463 2:154725518-154725540 TAGGAAAAAAACACTGGGAGTGG - Intronic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
941064600 2:160887245-160887267 GAGGAGGAAATAAATGAGAGTGG + Intergenic
941089326 2:161156934-161156956 TAGGAAACTAATAATGAAAGGGG - Intronic
941163781 2:162063716-162063738 TAAGAGAAAAAAAGGGAGAGGGG + Intronic
941442361 2:165554185-165554207 TAGGAGAAAAAACAGGAGTGTGG - Intronic
941611707 2:167669051-167669073 TAAGAGAAAGATAAAGAGAAAGG - Intergenic
941613579 2:167692879-167692901 TGGGAGAAAACTGATGAGATGGG + Intergenic
941848604 2:170156988-170157010 TAGGATAGAAATAATGTGAATGG - Intergenic
942068147 2:172291297-172291319 CAGGAGAGAAAGAAAGAGAGTGG - Intergenic
942860665 2:180606937-180606959 TATAAGAAAAATAAAGAGAATGG - Intergenic
942893572 2:181021452-181021474 AAAGAGAAAAAGAAAGAGAGAGG - Intronic
942911621 2:181251337-181251359 TATAAGAATAATGATGAGAGTGG + Intergenic
943458183 2:188134692-188134714 AAGGAGAAAGAGACTGAGAGAGG + Intergenic
943851643 2:192730495-192730517 AAGGAGAAAAATAAGCAGCGGGG - Intergenic
943865840 2:192923784-192923806 TAGCAGAGAAATCATTAGAGAGG - Intergenic
943883665 2:193182671-193182693 TATGAAAAAAAGAATGAGACAGG - Intergenic
943917553 2:193655885-193655907 TAGGTGAAAAACAGAGAGAGAGG - Intergenic
944365882 2:198919163-198919185 CAGGAGCAAAATAATGTGGGTGG - Intergenic
944523816 2:200598116-200598138 AAGGAGAAAAAGAGGGAGAGAGG + Intronic
945224599 2:207520540-207520562 AAAAAGAAAAAAAATGAGAGGGG + Intergenic
945535256 2:211009466-211009488 TAGGAGAAAAATGATGGAAGTGG + Intergenic
945653043 2:212588815-212588837 TAGGAAAAAATTAGGGAGAGAGG + Intergenic
946048775 2:216843321-216843343 GAGGAGAAAAAGAGTGGGAGGGG + Intergenic
946325187 2:218981416-218981438 TAGAAGAAAAAAAGTGAAAGAGG + Exonic
946738241 2:222775767-222775789 TAGGGGAAAAATGATTACAGAGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
948724211 2:239921889-239921911 AAGGAGAAAAGGAAGGAGAGAGG - Intronic
1168944586 20:1742049-1742071 AAGGAAAAAAAAAAAGAGAGCGG + Intergenic
1171052861 20:21876792-21876814 AAGGTGTAAGATAATGAGAGTGG + Intergenic
1172318298 20:33974215-33974237 GAAAAGAAAAAGAATGAGAGAGG - Intergenic
1173356244 20:42293536-42293558 TAGGATACAAATGATGAAAGAGG - Intronic
1173635841 20:44556889-44556911 TATCATAAAAATAATGAGTGGGG - Intronic
1174059637 20:47823603-47823625 TGGGAGTAATTTAATGAGAGAGG - Intergenic
1174657167 20:52181243-52181265 GAGGATAAAAATAAACAGAGAGG - Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175533121 20:59688241-59688263 TATGACAAAAATCATGAAAGTGG + Intronic
1176982554 21:15399887-15399909 TAAGAGAAAAAGACTGAGTGAGG - Intergenic
1177170117 21:17645536-17645558 TAGTAGAAGAATTGTGAGAGAGG - Intergenic
1177531043 21:22358433-22358455 TAGTAGAATAAATATGAGAGTGG + Intergenic
1178684557 21:34701044-34701066 TAGGAGAAAAAAAATCAGTGAGG + Intronic
1181964053 22:26644225-26644247 GAGGAGAAAAAAAAAAAGAGGGG - Intergenic
1182046833 22:27281452-27281474 TAGGAGGAAAATACTGAGTCTGG - Intergenic
1182739613 22:32558206-32558228 TAGGAGGAAAATTAGGAGAAAGG + Intronic
1182966525 22:34526650-34526672 TAGGGGAACAAAAAAGAGAGAGG - Intergenic
1183874646 22:40769073-40769095 TAGGAGAAAAATGATCATAAAGG - Intergenic
1203240895 22_KI270733v1_random:17894-17916 TAGGAAAAAAATAGTTAGAATGG + Intergenic
949239503 3:1853062-1853084 TAGGAGAAAAACTCTGAAAGAGG - Intergenic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950887675 3:16375253-16375275 TAGGAGAAAGATTAGGAGAGAGG + Intronic
951047166 3:18052874-18052896 TAAGAGAAAAAGTAGGAGAGGGG - Intronic
951252015 3:20404762-20404784 TTGGAGAACAATAAAGGGAGAGG + Intergenic
951303656 3:21029528-21029550 TAGGTGAAAAAAAATGTCAGAGG + Intergenic
951386231 3:22045971-22045993 GGGAAGAAAAATAATGAGGGAGG + Intronic
951488055 3:23236118-23236140 TAGGAGGAAAACCAGGAGAGAGG + Intronic
951721437 3:25702460-25702482 AAGTAGAAAAATAATAAGACTGG + Intergenic
951783601 3:26392454-26392476 TAGGAGAGAGATAATGGGACAGG - Intergenic
951947366 3:28155431-28155453 TAGGAAAATAAGAATTAGAGTGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952129121 3:30338659-30338681 AAGGAGCAAAATATAGAGAGTGG - Intergenic
952165566 3:30744814-30744836 TAATAGAAAACAAATGAGAGTGG + Intronic
952588380 3:34920867-34920889 TAGGAGAAAAGTCAGAAGAGTGG - Intergenic
952659273 3:35824685-35824707 TAGGTGAAAACTAATGGGGGAGG - Intergenic
952738695 3:36715241-36715263 TGAGAGAAAAACAATGAAAGAGG - Exonic
952779436 3:37080763-37080785 AAGGAGAAAAAACATGAAAGAGG + Intronic
953081539 3:39624414-39624436 TAATAGACAAAAAATGAGAGGGG + Intergenic
953113929 3:39972755-39972777 TAGAAGAAAAAAATTGAAAGGGG - Intronic
953776838 3:45826203-45826225 TATTAGAAAAATAAGGAGAGGGG + Exonic
954050805 3:47975470-47975492 GAGGAGAAAAATAGAGAGGGAGG + Intronic
954554740 3:51508965-51508987 TAGGAGAAAAGAAATTGGAGAGG - Intergenic
955359133 3:58257853-58257875 TAGGACAAGAATAATAACAGTGG - Intronic
955375063 3:58387792-58387814 GAGGAGAGAAAGAAGGAGAGAGG + Intronic
955469315 3:59269674-59269696 GAGGAGAAAAAGAAAGAGATAGG - Intergenic
955619320 3:60845284-60845306 TAAGAAAAAAATAATTAGAAAGG + Intronic
956578338 3:70781040-70781062 CAGGAGAAAAATAATCAGATAGG + Intergenic
956682034 3:71789817-71789839 AAGGAGAAAAATCATAAGAATGG + Intergenic
956820936 3:72953612-72953634 TAACAGATAAACAATGAGAGTGG - Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957107021 3:75902919-75902941 AAGGAGAACAGTCATGAGAGAGG - Intergenic
957309721 3:78504446-78504468 TAGAAGGAAAAAAATGAGGGAGG + Intergenic
957616183 3:82530486-82530508 TAATAGAAAAATAATGGAAGGGG - Intergenic
958458375 3:94362393-94362415 CAAGAGAAAACTAATCAGAGAGG - Intergenic
958464450 3:94441148-94441170 TAAGAGAAAAATAGTAAGGGAGG + Intergenic
958686727 3:97408110-97408132 GAGGAGAAAAGCAAAGAGAGGGG + Intronic
958761923 3:98319612-98319634 CAGGAGAAAAATAACGTCAGGGG + Intergenic
959220293 3:103509945-103509967 TAGGAAAAAATTAATGTCAGTGG - Intergenic
959230311 3:103640805-103640827 AAGTAGGAAAATCATGAGAGTGG - Intergenic
959457641 3:106582802-106582824 TAGAATAAAAATAATGAAACAGG - Intergenic
959592020 3:108091404-108091426 GAGGAGAAAAGTAGAGAGAGAGG - Intergenic
959628128 3:108476530-108476552 TAGAAGAAAAGGAAGGAGAGAGG + Intronic
959711645 3:109391605-109391627 GAGGAGAAAAAAAATTAGAGAGG + Intergenic
959839919 3:110963691-110963713 AAGCAGAAAAATAATAATAGAGG + Intergenic
959992268 3:112642698-112642720 GAGTAGAAAATTAAAGAGAGAGG - Intronic
960499683 3:118421653-118421675 TAAGAGGAAAAGAAAGAGAGTGG + Intergenic
960649129 3:119926625-119926647 GAGGACAGAAATAATGAGATGGG - Intronic
960790511 3:121425442-121425464 TAGGAGAAAAATTATGGCGGTGG - Intergenic
960931708 3:122857869-122857891 TAGAAGGAAAATAATGACAAAGG - Intronic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
962110971 3:132447571-132447593 TAAGAAAAAAATAATCATAGTGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962874824 3:139527776-139527798 TGGGAGAATAAGAATAAGAGAGG + Intronic
963015444 3:140820193-140820215 GAGAAGAGAAAGAATGAGAGAGG - Intergenic
963277310 3:143345594-143345616 GAGGATAAAAATGATGAGAGAGG + Intronic
963292568 3:143507178-143507200 AATGATAATAATAATGAGAGAGG - Intronic
963326165 3:143865733-143865755 TAGGAGAAAAGAAAAGATAGAGG - Intergenic
963565917 3:146930283-146930305 TATGGCAAAAATAATGAAAGTGG - Intergenic
964108863 3:153068454-153068476 TAGGAGAAAAATAAAAGAAGGGG - Intergenic
964149328 3:153505730-153505752 TTTGAGAAAAATAATTACAGAGG - Intergenic
964161240 3:153648258-153648280 AATGAGAAAAATAATGAAAATGG + Intergenic
964237081 3:154544272-154544294 TATTAGGAAAATAAAGAGAGGGG - Intergenic
964280612 3:155060565-155060587 AAGGAGCAAAATGGTGAGAGTGG + Intronic
964523485 3:157591991-157592013 TAGGAGAAAAATAACAAGGAGGG - Intronic
964978997 3:162655562-162655584 TAGGAGACAAATAATGGGGGTGG - Intergenic
965484801 3:169265711-169265733 TAGGAGAAATCTAATGCAAGAGG + Intronic
965615368 3:170586524-170586546 CAGGAAAGAAAAAATGAGAGAGG + Intronic
965935624 3:174106862-174106884 TAGAAGAAAAAAAAGGAGAAAGG - Intronic
966016564 3:175146646-175146668 AAGAAGAAAAATAATGAAAGAGG + Intronic
966176027 3:177138590-177138612 TGGGAGAAAAAAAAAGGGAGAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967410412 3:189161251-189161273 TAGCAAAAGAAAAATGAGAGAGG - Intronic
967811425 3:193764349-193764371 GAGGAGAAAAACAATGTGAAGGG - Intergenic
968697427 4:2039909-2039931 TATGAGAAAAATTATAAGAAAGG + Intronic
968854382 4:3108260-3108282 CAAGAGAAAAAACATGAGAGAGG - Intronic
969141179 4:5074421-5074443 TAGGAAAAAAATAAATACAGTGG - Intronic
970101088 4:12523857-12523879 TAGAAGGAAAACACTGAGAGTGG + Intergenic
970488019 4:16543946-16543968 TAGGAAAGAAAAAAAGAGAGAGG - Intronic
970713166 4:18888028-18888050 TAGGAGAAACATCAGGAGAGTGG + Intergenic
971494581 4:27250463-27250485 TGGGAGCAAAAGAAAGAGAGGGG + Intergenic
971562780 4:28102514-28102536 AAGAAGAAAAATATTGAGGGTGG + Intergenic
971734237 4:30425581-30425603 AAGGAGAAAAACAAGGAAAGAGG + Intergenic
972037289 4:34541634-34541656 TAGGATAAAAATACTGAGGAGGG + Intergenic
972303712 4:37811421-37811443 TAGGAGAAAAACAGAGAGTGTGG - Intergenic
972783631 4:42307460-42307482 TAGAATAAAAATATTGAAAGAGG - Intergenic
973722716 4:53741606-53741628 TTGGAGAAAGAAAACGAGAGAGG + Intronic
973983840 4:56330734-56330756 TTAGAGAAAAATAATGAACGGGG + Intergenic
974090941 4:57310870-57310892 TAGGAGAAAAATGATAATAGAGG - Intergenic
974354399 4:60793820-60793842 TATGAGAACAATACTGGGAGGGG + Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
975091010 4:70404265-70404287 TAGGAGAAAAATCAGGAGAGTGG - Intronic
975823790 4:78298924-78298946 TAGGATAAATATGATAAGAGAGG + Intronic
976890999 4:90047633-90047655 TAGAGGAAAAATGAAGAGAGGGG + Intergenic
976961353 4:90980053-90980075 AAGGAGATAAATAATCAGGGTGG + Intronic
977831052 4:101593449-101593471 AAGGAGAAAAATAATTACACAGG - Intronic
977915129 4:102583737-102583759 TAGGAGAATAATAATTAAGGTGG - Intronic
978135473 4:105253071-105253093 AAGGAGAAAAACAATGTCAGAGG - Intronic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979038155 4:115752073-115752095 TAGGCGAAAAGTAAAGAGACAGG - Intergenic
979373401 4:119915784-119915806 GCTGAGAATAATAATGAGAGTGG + Intergenic
979436271 4:120695955-120695977 CATGAAAAATATAATGAGAGAGG + Intronic
979495598 4:121379608-121379630 TGGGGGAAAAAAAATGACAGAGG - Intronic
980094837 4:128478826-128478848 CAGGAGAAAAACAAAGACAGAGG - Intergenic
980846038 4:138326429-138326451 TTGGAGATAAATAATAAAAGTGG + Intergenic
980987607 4:139710934-139710956 TAGGGGAAAAAGAAAGAGAGTGG + Intronic
981249860 4:142586758-142586780 AAGGAGAGAATTAATGAAAGGGG + Intronic
981401679 4:144321218-144321240 TTTGAGAAAAATAATTAGTGAGG - Intergenic
981489783 4:145327260-145327282 AAAGAGAAACATAAGGAGAGAGG - Intergenic
981651892 4:147069744-147069766 TGGCAGAAAAACAATGAGATTGG - Intergenic
981820176 4:148878890-148878912 AAAGAAAAAAATAATGGGAGAGG - Intergenic
982213552 4:153060493-153060515 TAGTAGAAAAATAATGAGGCCGG + Intergenic
982713877 4:158786224-158786246 AAGGAGAAATATAAACAGAGTGG - Intronic
983057324 4:163113330-163113352 TAGGAGAGGAATTATGAAAGTGG - Intronic
983379732 4:166976656-166976678 AAGGAGAAAAATAAAGAAGGAGG - Intronic
983563047 4:169120526-169120548 TAGTAGAAAAATACTGAAAATGG + Intronic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984681175 4:182610675-182610697 TGGGAGAAAAAAATAGAGAGAGG - Intronic
985267508 4:188163737-188163759 TATGAGAAAAAAAATCACAGGGG + Intergenic
985378390 4:189366214-189366236 TAAATAAAAAATAATGAGAGAGG + Intergenic
985860873 5:2469719-2469741 AAGGGGAAAATTAATGACAGCGG - Intergenic
986295209 5:6431921-6431943 TAGGAGGACACTAAGGAGAGAGG - Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986983944 5:13479550-13479572 TAGGAGGAGAGTAAAGAGAGGGG - Intergenic
987569788 5:19641776-19641798 TTGAAAAGAAATAATGAGAGTGG - Intronic
987679314 5:21115368-21115390 TAGAAGAAAAAAAGTGGGAGGGG - Intergenic
987888268 5:23840005-23840027 CAGAAAAATAATAATGAGAGAGG - Intergenic
989014931 5:36919341-36919363 TAGGAGAGAAATAAAGATAATGG - Intronic
989108177 5:37882972-37882994 ACGGACAAAAATAATGAGAATGG - Intergenic
989293461 5:39796109-39796131 TAGGAGGAAAACAAAGAGAAAGG + Intergenic
989605420 5:43239784-43239806 GAGGATAAAAAGAATAAGAGTGG - Intronic
989812856 5:45697617-45697639 GAGGAAAAAAAAAATGAGTGGGG + Intergenic
990032081 5:51273904-51273926 TGGGAGAAAAATACAAAGAGGGG - Intergenic
990504639 5:56432291-56432313 AAGGAGAAAACGAATGAAAGAGG - Intergenic
990619071 5:57540411-57540433 AGGGAGAAAAATAAAGAGAGAGG - Intergenic
990715376 5:58630659-58630681 TGGGAGAAAGACAATGAGAAAGG + Intronic
992810894 5:80387416-80387438 TAGGAGAAAAATATTAACTGGGG - Intergenic
992990195 5:82275977-82275999 TAGGATAAAAAAAATAAGGGGGG + Exonic
993598269 5:89886988-89887010 TAGGACAAAAATAGTGAAAACGG + Intergenic
993694560 5:91045627-91045649 TTGAAGAAAAGTAGTGAGAGTGG - Intronic
993778442 5:92033048-92033070 AAGAAGGAAAATAATAAGAGGGG - Intergenic
993808950 5:92451161-92451183 TAGGAACAAAATAAAGAGAAAGG + Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
994346415 5:98692770-98692792 TTGAATAAAAGTAATGAGAGAGG + Intergenic
994383907 5:99105136-99105158 TAGGAGAAAAATAAAATGAAAGG + Intergenic
994690685 5:103015912-103015934 TAGGAAAAATATAATGATGGGGG - Intronic
994740601 5:103613090-103613112 TGGGTGATAAATAATGAGAAAGG - Intergenic
994930231 5:106173244-106173266 TTGGAGAACAAACATGAGAGGGG - Intergenic
995023763 5:107396162-107396184 AAGGAGAATAATAATGAAAGGGG - Intronic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996338688 5:122412485-122412507 TAGGAGAAAAATGAGGAGAGAGG - Intronic
996452884 5:123646892-123646914 ATGGAAAAAAATAATGAGGGAGG - Intergenic
996512513 5:124332797-124332819 TAGGAGAATAAGAAAGATAGGGG + Intergenic
997163166 5:131630983-131631005 TAGGAGAAAAACCGAGAGAGTGG - Intronic
997970108 5:138394419-138394441 TATGAGAAAAATAAGGAAAGAGG + Intronic
998068092 5:139174966-139174988 AAAGAAAAAAATAATGAAAGTGG + Intronic
999856100 5:155595869-155595891 AAAGTGAAAAATAATGACAGAGG - Intergenic
1000294444 5:159900928-159900950 TTTGAGAAGAATAATGAAAGAGG + Intergenic
1000552214 5:162681104-162681126 AAGGAGAAAGAGAATGATAGGGG + Intergenic
1000744195 5:165011039-165011061 TGGGAAAAAAATCATGAAAGGGG - Intergenic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1005194981 6:23271834-23271856 TAGGAGAAAAAAAAAGTGAGTGG - Intergenic
1005336254 6:24799816-24799838 GAGGAGAAAAATTAGGAGTGTGG - Intronic
1005457658 6:26036538-26036560 GTGGAGAAAAATAAAGAAAGGGG + Intergenic
1005506869 6:26476975-26476997 GAGGAGGAAGAAAATGAGAGTGG - Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1005845452 6:29773419-29773441 AAGGAGAGAAAGAAGGAGAGAGG - Intergenic
1006337706 6:33429013-33429035 TAGGAGAGAAGGAATGAGAGAGG + Intronic
1006868103 6:37225489-37225511 AAGGAAAAAAATAAAAAGAGTGG + Intronic
1007647508 6:43394370-43394392 TGGGAGAAAAATAATGTAAAAGG + Intergenic
1007861560 6:44915109-44915131 TGGGATAAAAGTAAAGAGAGTGG + Intronic
1008153011 6:47978109-47978131 GAGAAGAAAAATAATGAGAAGGG - Intronic
1008193224 6:48485966-48485988 TGGGTGAAAAATAATAAGAAAGG + Intergenic
1009529682 6:64795801-64795823 TTGGAGAAAAATAAACACAGCGG + Intronic
1009736822 6:67687485-67687507 AAGGAGAAAAATAAAAAGATGGG + Intergenic
1010700470 6:79038594-79038616 TAGGGGAAAAAAAAGAAGAGTGG - Intronic
1011013789 6:82732362-82732384 AAGCAGAAAAATACTGAAAGAGG - Intergenic
1011047743 6:83105000-83105022 CAGGAGAATAACAAGGAGAGTGG - Intronic
1011112145 6:83850488-83850510 CAGGAAAAAAATAATGAGTTTGG - Intergenic
1011355798 6:86472299-86472321 TAAGAGAAGAATCATGGGAGAGG + Intergenic
1012221926 6:96658952-96658974 TGAGACAAAAATAATGAGAAAGG + Intergenic
1012329133 6:97962263-97962285 TAAGAGAAATAAAATGGGAGAGG - Intergenic
1012687447 6:102269626-102269648 TAAAAGAAAAATAGTGGGAGCGG - Intergenic
1013680202 6:112517020-112517042 AAATAGAATAATAATGAGAGGGG + Intergenic
1013737274 6:113242356-113242378 TACTAGAAAAATAATGAAATGGG + Intergenic
1014241122 6:119018541-119018563 CAGGAATAAAATAATGAGATGGG + Intronic
1014348055 6:120300669-120300691 AAGCAGAAAAAAAATGACAGAGG - Intergenic
1014378734 6:120712490-120712512 TGGAAGAAAAAAAAAGAGAGAGG + Intergenic
1014543984 6:122710934-122710956 TGGGAAAAAAAGAATGAGAAGGG + Intronic
1014791952 6:125682457-125682479 TTTGAGAAAAAAGATGAGAGAGG - Intergenic
1014947088 6:127511637-127511659 TAGTAGAAAAATATGGAGACTGG - Intronic
1014950146 6:127544817-127544839 TCTGAGAAAAATAAAGAAAGAGG - Intronic
1016216751 6:141613530-141613552 TTGGAGGAAAATATTTAGAGAGG - Intergenic
1016371991 6:143384792-143384814 TAACAGAAAAATAATAGGAGCGG - Intergenic
1016861215 6:148720630-148720652 TAAGAGAAAAAGAAGGAGCGTGG - Intergenic
1017369571 6:153689194-153689216 TAGGGGAAAAATAAAGCGAGGGG + Intergenic
1018337456 6:162809326-162809348 TAGCAGAAATATAAAGACAGAGG + Intronic
1018411997 6:163558956-163558978 TAAGAGAATAAAAATAAGAGTGG - Intronic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1018735986 6:166687584-166687606 TAATAGAAAAATAAATAGAGTGG - Intronic
1018756105 6:166851030-166851052 TAGCAGAGAACTAATGAGTGAGG - Intronic
1018777211 6:167028597-167028619 TAGGAGAATAATGATGTTAGTGG + Intronic
1020883868 7:13798220-13798242 TTAGAGAAAAAGAATCAGAGTGG + Intergenic
1021053974 7:16024178-16024200 TAGGAGGAAAGTAAGAAGAGAGG - Intergenic
1021452573 7:20796683-20796705 AAGCAGAAAAATAATCAAAGTGG - Intergenic
1021791065 7:24206006-24206028 TAGGAAGAAAATCATGACAGTGG + Intergenic
1021813003 7:24422198-24422220 TAGCAGTAAAATAAAGTGAGGGG - Intergenic
1022422189 7:30233881-30233903 TAGATGACAAAGAATGAGAGAGG + Intergenic
1022989351 7:35693318-35693340 CAGGAGAAAAATGTTGAAAGGGG + Intronic
1023826101 7:44010775-44010797 TGAGAGAAAGATATTGAGAGAGG + Intergenic
1024180656 7:46890700-46890722 TAGGGGAATAATCCTGAGAGTGG + Intergenic
1024186042 7:46949016-46949038 TTGGAGAGAAATAAAGTGAGGGG - Intergenic
1024835407 7:53512336-53512358 GAGGAGAAAGAAAAAGAGAGAGG + Intergenic
1026089672 7:67289644-67289666 TGAGAGAAAGATATTGAGAGAGG + Intergenic
1026215541 7:68345374-68345396 TAGGACAAAAATAATAGGAATGG + Intergenic
1026724613 7:72860865-72860887 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1026746753 7:73019090-73019112 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1026750405 7:73047233-73047255 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1026754052 7:73075343-73075365 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1026757703 7:73103379-73103401 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1027032857 7:74903668-74903690 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1027089700 7:75290108-75290130 TGAGAGAAAGATATTGAGAGAGG + Intergenic
1027093345 7:75318036-75318058 TGAGAGAAAGATATTGAGAGAGG + Intergenic
1027096988 7:75346003-75346025 TGAGAGAAAGATATTGAGAGAGG + Intergenic
1027119265 7:75504955-75504977 TGAGAGAAAAATATTGAGAGAGG + Intergenic
1027146170 7:75696344-75696366 AAGGACAAAGAAAATGAGAGAGG - Intronic
1027272560 7:76530656-76530678 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1027322360 7:77021685-77021707 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1027326013 7:77049739-77049761 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1027659898 7:80976383-80976405 AAGGAGAAAAATAATAAAACGGG - Intergenic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1029315784 7:99712076-99712098 CAGGAAAAAAATCAAGAGAGGGG - Intronic
1029398097 7:100322988-100323010 TGAGAGAAAGATATTGAGAGAGG + Intergenic
1029559350 7:101292194-101292216 TAGTAGAAAAATAAAGTGACTGG + Intergenic
1029718228 7:102345079-102345101 TGAGAGAAAGATATTGAGAGAGG - Intergenic
1029754387 7:102564177-102564199 TGAGAGAAAGATATTGAGAGAGG + Intronic
1029772336 7:102663258-102663280 TGAGAGAAAGATATTGAGAGAGG + Intronic
1029846419 7:103416744-103416766 AAGGAGGAAGAAAATGAGAGAGG - Intronic
1029872080 7:103705013-103705035 CAGGAGAAAAATCAAGAGGGTGG - Intronic
1029942476 7:104495082-104495104 TAGGAGAGAAAGAAGTAGAGAGG - Intronic
1029968609 7:104766783-104766805 TACGAGAAAAATAATGGGAGTGG - Intronic
1029985857 7:104922770-104922792 TAGAAGAAAAATAAATATAGAGG + Intergenic
1030573905 7:111262466-111262488 TGGGAGAAAAGAAATGGGAGTGG + Intronic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1030907351 7:115203101-115203123 GAGGAGAAAAAGAGAGAGAGAGG + Intergenic
1030956286 7:115856576-115856598 TAAGAGAAAAATCCAGAGAGTGG + Intergenic
1031707748 7:125002949-125002971 TAGAATAAAAATAATTAGACTGG + Intergenic
1031727229 7:125255642-125255664 TAGAACAAAAGTAATGATAGGGG - Intergenic
1032753475 7:134865617-134865639 TAGGAGAAAAAGAATTTGCGTGG + Intronic
1033631106 7:143158978-143159000 TAGGAGAAATATAAATGGAGAGG - Intergenic
1033830758 7:145249615-145249637 TAGAAGAAAAAAAATGAGACTGG + Intergenic
1033851371 7:145499641-145499663 TAGAAGAAAAATTAGGAAAGAGG + Intergenic
1034656406 7:152733102-152733124 CAAGAGAAAAACAATGAAAGTGG - Intergenic
1036054495 8:5236370-5236392 TAGCAAAACAATAAAGAGAGTGG - Intergenic
1036409549 8:8486467-8486489 CAGGAGAAAAACAATTAGAATGG - Intergenic
1036539915 8:9696285-9696307 GAGGAGGAAAATAAGGAGTGTGG + Intronic
1036598382 8:10236281-10236303 CAGGAGAATAAGAATGGGAGAGG + Intronic
1036920145 8:12844793-12844815 TAGGAAAAAAATAATGCAAGAGG + Intergenic
1036990731 8:13590639-13590661 TAGTAATAAAATAATCAGAGTGG + Intergenic
1037083819 8:14821286-14821308 GAACAGAACAATAATGAGAGAGG + Intronic
1037142256 8:15533663-15533685 TTGGAGAAAAAACCTGAGAGGGG + Intronic
1037524428 8:19710914-19710936 GAGGAAAAAAAAAATCAGAGAGG - Intronic
1037703362 8:21295417-21295439 AAGGAGAAAAATGATGAGTAGGG - Intergenic
1038115264 8:24546700-24546722 TAGGAGAAAAATAATAATGAGGG + Intergenic
1038830019 8:31046839-31046861 CAGTAGAAAAATAATTAGACTGG + Intronic
1039273549 8:35909395-35909417 ACGGGGAAAAATAATAAGAGGGG + Intergenic
1039343108 8:36672652-36672674 TAGGACAAAACTGATGAGATAGG - Intergenic
1039672104 8:39612917-39612939 TACCAGAAAAATAATGGGGGAGG - Intronic
1039824520 8:41161700-41161722 AAGGAGAAAAGGAAGGAGAGAGG - Intergenic
1040681546 8:49816846-49816868 AAACAGAAAAATGATGAGAGAGG - Intergenic
1040750061 8:50694404-50694426 GAAGAGAACAATAATGAGTGAGG + Intronic
1041576869 8:59407648-59407670 GAGAAGAAAATTAATGAAAGAGG + Intergenic
1042015214 8:64301672-64301694 TAGGAGAAAAATCAGAAGAGAGG - Intergenic
1042191241 8:66189660-66189682 TAGGGGAAAACTAAAGGGAGGGG - Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042482064 8:69315239-69315261 TGGTGGTAAAATAATGAGAGAGG + Intergenic
1042593650 8:70422986-70423008 TAAAAGAAAAATAATGAGTGGGG - Intergenic
1042601730 8:70505632-70505654 AAAGAGAAAAATAAAGAGGGAGG - Intergenic
1042612022 8:70609588-70609610 CAGGAGAAAAATAAAGCAAGGGG + Intronic
1042623676 8:70733113-70733135 AAGGAAAGAAATAAAGAGAGTGG + Intronic
1043557993 8:81456325-81456347 TAGAAGAAAGATAATGAAAGAGG - Intergenic
1043908483 8:85833648-85833670 TAGGGGCAAAAAAATGGGAGAGG - Intergenic
1044068124 8:87723225-87723247 TAGGCAAAGAATCATGAGAGTGG + Intergenic
1044167276 8:89002200-89002222 TAGAAGAAAAATCCTGAGTGAGG - Intergenic
1044399259 8:91751207-91751229 TAGGAGATAAATTTTGAGGGGGG - Intergenic
1044950668 8:97432726-97432748 TAGTAGAAAAATCATCAGAGAGG + Intergenic
1044974228 8:97647553-97647575 TAAGAGCAAGATAATGTGAGAGG + Intronic
1045092478 8:98760637-98760659 AAGGAAAAAATTAATGAGACAGG - Intronic
1045308073 8:100976038-100976060 TATGGGAAAAATAATCACAGAGG - Intergenic
1046481143 8:114820735-114820757 TAAGAGCAAAAGAGTGAGAGAGG + Intergenic
1046928780 8:119822752-119822774 TGGGAGAGAAGTAATGAGAGGGG - Intronic
1047181228 8:122590000-122590022 TAGAAGAAAAAGATAGAGAGTGG + Intergenic
1047668535 8:127119172-127119194 TAGGAAAATTATAAAGAGAGAGG - Intergenic
1047680010 8:127245024-127245046 TAGAAAAAAAAAAAGGAGAGGGG + Intergenic
1047688685 8:127328662-127328684 GAGGAGGAGTATAATGAGAGAGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1048016693 8:130503540-130503562 TAAGATTAAAATTATGAGAGGGG - Intergenic
1048257870 8:132919100-132919122 TAGGGGTAAAATAAAGAGGGGGG - Intronic
1048374141 8:133807534-133807556 TAGGCTAAGACTAATGAGAGAGG + Intergenic
1048728631 8:137413083-137413105 TGGGTGAATAATAATCAGAGAGG + Intergenic
1048741723 8:137568167-137568189 TGGGTGAAAAATAATTAGAAAGG - Intergenic
1048904364 8:139073615-139073637 AAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1050075039 9:1854424-1854446 TTTGAGAAGAATAATGACAGGGG - Intergenic
1050078178 9:1887220-1887242 TAGGGGATATATAATAAGAGGGG - Intergenic
1050259109 9:3822375-3822397 TAGCAGAAGAATAAGCAGAGGGG + Intergenic
1050274448 9:3982206-3982228 TAGGAAAAAAAAAAACAGAGAGG - Intronic
1050600869 9:7248925-7248947 TAGGAGTAAAATTAGTAGAGTGG + Intergenic
1051546148 9:18278044-18278066 TAGGGGAAGAATAATTAAAGTGG - Intergenic
1051989382 9:23133119-23133141 AAGGAGAAAAAGAAACAGAGTGG + Intergenic
1052133187 9:24876290-24876312 TAGGAGAAAAACAGAGTGAGAGG - Intergenic
1052312363 9:27081192-27081214 TAGGAGATAAATTAGGAGATTGG + Intergenic
1052490338 9:29158983-29159005 TAGGAGGAAAATAAAGAGTTAGG - Intergenic
1052505372 9:29346999-29347021 GAGAAGAGAAATAAAGAGAGAGG - Intergenic
1053365766 9:37521500-37521522 TTGGAGAAAAAAAAAGACAGTGG + Intronic
1053469286 9:38334500-38334522 TAGGGGAAACAGAATGAAAGAGG - Intergenic
1053885715 9:42644076-42644098 TGGGAGAAAGATAAAGAGGGTGG - Intergenic
1054224733 9:62451525-62451547 TGGGAGAAAGATAAAGAGGGTGG - Intergenic
1055800598 9:80032030-80032052 TAGGAGACAGAGAATGAGAGGGG + Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056517564 9:87369741-87369763 TATGAGGAAAATAATCAGACTGG - Intergenic
1056598729 9:88029331-88029353 AAGAAGAAAAATAATGAGTAAGG + Intergenic
1058167801 9:101639912-101639934 TAAGAGAAAAATAAAGCAAGAGG - Intronic
1058471945 9:105288821-105288843 TTCTAGAAATATAATGAGAGAGG + Intronic
1059184071 9:112249437-112249459 TAGGAAGAAAGTAAGGAGAGTGG + Intronic
1059223289 9:112646462-112646484 GAGAAGAAACATAATGAAAGTGG + Intronic
1059369862 9:113820080-113820102 TTGAAGAAAAATAATGAAATGGG + Intergenic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1059709798 9:116857005-116857027 GTGGAGAAAAATAATGGGAAAGG - Intronic
1187158858 X:16745829-16745851 AAGGACAAAGAGAATGAGAGAGG - Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187682668 X:21783389-21783411 CAGGAGAAAAATAATGAAATAGG - Intergenic
1187811958 X:23189253-23189275 TAGGAGCAAATTAACGAGATGGG + Intergenic
1188342218 X:29018162-29018184 AAAGAGTAAAACAATGAGAGTGG - Intronic
1188785611 X:34342654-34342676 TAGCAGGAAAATAATGTGACAGG + Intergenic
1188973759 X:36648976-36648998 TAGGAAGTAAATGATGAGAGGGG + Intergenic
1189607138 X:42691305-42691327 CAGGAGAGAAACAAAGAGAGTGG + Intergenic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1191853711 X:65605709-65605731 TACCAGAAAAATGATCAGAGTGG - Intronic
1192093504 X:68185667-68185689 TAAGAGAAAAAAAAAGAGAAAGG + Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1193266432 X:79476454-79476476 TATCAGAAAAGTAATGAGAAAGG - Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1193912659 X:87324680-87324702 TAATACAAAAATAATGAGAGAGG - Intergenic
1194067582 X:89281361-89281383 TTGAAGAAAAGTGATGAGAGTGG - Intergenic
1194436913 X:93877790-93877812 TTGGATAAAAGTAGTGAGAGAGG - Intergenic
1194553069 X:95325026-95325048 TAAGGGAAAAATAATGAAAAAGG - Intergenic
1194679476 X:96834737-96834759 TATGAGAAAAAAAATGTTAGCGG + Intronic
1194876047 X:99188790-99188812 TATGTGAAAAATAATGACAGAGG + Intergenic
1195267205 X:103194048-103194070 TAGAAGGAAAATAAGGAGACAGG + Intergenic
1195416186 X:104621755-104621777 CAGGAGAGAAATGAAGAGAGAGG + Intronic
1195830273 X:109050022-109050044 TAGCAAAGAAATAATGATAGTGG + Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1196252485 X:113478788-113478810 TAGGATAAAAATAAAGGGACCGG - Intergenic
1196572116 X:117278693-117278715 TACGGTAAAAATAATGACAGTGG - Intergenic
1197267342 X:124389136-124389158 TAGGAGAAAAATAATTATTTGGG - Intronic
1197288950 X:124631597-124631619 TAGGATAAAAATAATGAATCTGG + Intronic
1198624701 X:138557713-138557735 TAGGAAAAAAATAACTAGAATGG - Intergenic
1198732272 X:139745132-139745154 TAGGAGAAAATTACTGATGGCGG - Intronic
1199559023 X:149142916-149142938 CAGAAGAAAAATAATGAGTTTGG + Intergenic
1199875564 X:151925331-151925353 TAGGGGAAAAGTAACGAGTGTGG + Intergenic
1200721734 Y:6615552-6615574 TTGAAGAAAAGTGATGAGAGTGG - Intergenic
1200835402 Y:7726975-7726997 CAGGAGAAAGATTAAGAGAGAGG + Intergenic
1201462062 Y:14237205-14237227 TATGAGAAAGAGCATGAGAGTGG - Intergenic
1201622386 Y:15974374-15974396 CAGAAGAAAATTAATGATAGTGG + Intergenic
1201931719 Y:19357385-19357407 TAGCAGAAAAACAATGAGTATGG + Intergenic