ID: 1005822211

View in Genome Browser
Species Human (GRCh38)
Location 6:29607321-29607343
Sequence CAGGGAGCTCATGGTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005822203_1005822211 7 Left 1005822203 6:29607291-29607313 CCCTAAGGGAGAGTGGGCAGGGA 0: 1
1: 0
2: 2
3: 26
4: 273
Right 1005822211 6:29607321-29607343 CAGGGAGCTCATGGTGGCACAGG 0: 1
1: 0
2: 2
3: 23
4: 282
1005822204_1005822211 6 Left 1005822204 6:29607292-29607314 CCTAAGGGAGAGTGGGCAGGGAG 0: 1
1: 0
2: 4
3: 48
4: 461
Right 1005822211 6:29607321-29607343 CAGGGAGCTCATGGTGGCACAGG 0: 1
1: 0
2: 2
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005822211 Original CRISPR CAGGGAGCTCATGGTGGCAC AGG Intronic
900089133 1:911742-911764 CAGGCAGCTCCTGGGTGCACGGG + Intergenic
900209002 1:1444358-1444380 CAGGGGGCCCATGCTGGCCCAGG + Intergenic
900209017 1:1444408-1444430 CAGGGGGCCCATGCTGGCCCAGG + Intergenic
900227293 1:1539338-1539360 CAGGAAGCGCCTGCTGGCACAGG - Intronic
900438902 1:2643711-2643733 CAGGGAGCTCATGGCGGAGTCGG - Intronic
900795244 1:4703882-4703904 CAGGGAGCTCGGGGAGGCAGTGG - Intronic
902272752 1:15316419-15316441 CAGGGAGCTCAGGGAAGCCCAGG + Exonic
902518199 1:17001051-17001073 AATGGAGCTAATGGTGGTACCGG - Intronic
902612883 1:17607676-17607698 CAGGGAGAACATGGGGGCCCTGG - Intronic
902661813 1:17909663-17909685 AAGGGAGCAGATGGTGGTACAGG + Intergenic
902754190 1:18538207-18538229 CAGAGAGCTCAGGGAAGCACTGG + Intergenic
903443695 1:23407259-23407281 CAGGGAGGTAATGGTGGAAGTGG - Intronic
905875278 1:41428151-41428173 AAGGGAGCTCCGGGTCGCACTGG - Intergenic
906309772 1:44745431-44745453 AATTGAGCTCATGGTGGCAGGGG + Intronic
906707436 1:47905051-47905073 CAGGGAGCTCATGGTCAAAGAGG + Intronic
906957447 1:50386908-50386930 TAGGGTTCTCATGGTGGAACTGG - Intergenic
908120717 1:60983664-60983686 CATGGAGCTTAGGATGGCACTGG - Intronic
909361200 1:74760628-74760650 CAAGGAGCTCATGGTTTAACAGG - Intronic
911864249 1:102995889-102995911 CAGGGAGCAGATGGTGTCAGAGG - Exonic
912501142 1:110122536-110122558 CAGGGTGCTGGTGGGGGCACTGG - Intergenic
913352474 1:117876290-117876312 CAGGGATCTCATGGTGGGAAGGG - Intronic
913683884 1:121213513-121213535 CAGGGAGCTCTTTCTGGCAAAGG - Intronic
914035723 1:144001128-144001150 CAGGGAGCTCTTTCTGGCAAAGG - Intergenic
914153732 1:145066817-145066839 CAGGGAGCTCTTTCTGGCAAAGG + Intronic
914802905 1:150973957-150973979 AAGGGAGCTCCTGGTGGAACTGG - Intronic
914850059 1:151307663-151307685 CAGGGAGCTTATGGTTGAGCAGG + Exonic
915472630 1:156135074-156135096 CAGGGAGCTCAGGGTGGCCCAGG + Intronic
915605347 1:156946935-156946957 CAGTGACCTCATGCTGGCCCGGG - Exonic
915619660 1:157073342-157073364 CAAGGAGCTGATGCAGGCACTGG - Intergenic
916008252 1:160681166-160681188 CTGGGAGCTGAGGGGGGCACAGG - Intronic
916213681 1:162378467-162378489 CAGGTAGCTCATGGCGGAGCAGG - Intronic
916338734 1:163703830-163703852 CAGGGAACTCATGAAGGCACTGG + Intergenic
917732677 1:177891806-177891828 CAGGGAGGTCTAGGTGGCTCAGG - Intergenic
918069334 1:181123290-181123312 AAGGTAGCTCAAGGTGGCAAGGG + Intergenic
918340281 1:183562935-183562957 CAGGGAGCTGATGGAGGGGCAGG + Intronic
920471188 1:206232005-206232027 CAGGGAGCTCTTTCTGGCAAAGG - Intronic
920715818 1:208338849-208338871 GAGGGATTTCATGGTGCCACTGG + Intergenic
921442985 1:215210958-215210980 GAGTGAGCTCATGGTGGCACAGG - Intronic
921579870 1:216883626-216883648 CAGGGACCTCATGTTGGAGCAGG - Intronic
921664917 1:217857398-217857420 CAAGGAGCTCATTTTGGCAGTGG + Intronic
922766056 1:228157253-228157275 CTGGGAGCTGATGGTGGTGCAGG + Intronic
922950230 1:229552991-229553013 CAGAGACCTCATGGGTGCACAGG + Intronic
923405754 1:233657419-233657441 CGGGCAGATCATGGTAGCACAGG - Intronic
923752204 1:236756432-236756454 CAGGGTTCTAATGGTGGCAGCGG - Intronic
1062848963 10:728781-728803 CAGGGAGGGTATGGTGGCACAGG - Intergenic
1062848995 10:728906-728928 GGGGGAGGGCATGGTGGCACAGG - Intergenic
1062849032 10:729031-729053 TGGGGAGGGCATGGTGGCACAGG - Intergenic
1062849056 10:729107-729129 CAGGGAGGGCATGGCGGCACGGG - Intergenic
1062849079 10:729165-729187 GGGGGAGAGCATGGTGGCACGGG - Intergenic
1062973844 10:1668880-1668902 CTGTGAGCTCCTGGTGGCAAAGG + Intronic
1063665623 10:8058665-8058687 CAGGGCGGTCATGCTGCCACGGG - Exonic
1063714688 10:8515020-8515042 CAAGGAGCTGATGCGGGCACTGG + Intergenic
1064000231 10:11657793-11657815 CAGCAAACTCATGGTGGCAAGGG - Intergenic
1067475101 10:46559554-46559576 CTGGGACATCATGGTGACACAGG + Intergenic
1069744511 10:70706564-70706586 CAGGCAGCTTCTGGTGGCCCTGG - Intronic
1069776903 10:70932709-70932731 CATGGAGGAGATGGTGGCACAGG + Intergenic
1071375259 10:84995769-84995791 CATGGAGATCATAGTGTCACAGG + Intergenic
1072524331 10:96258201-96258223 GAGTGAGCTCATGGTGGAGCTGG + Intronic
1072638358 10:97192360-97192382 CAGGGAGGCCAAGGTGGCTCAGG - Intronic
1073049930 10:100660870-100660892 CAGGGAGCTCACACTGGGACAGG - Intergenic
1073280588 10:102351126-102351148 CAGGTAGCTCAAGGAGCCACGGG + Intronic
1073487207 10:103827112-103827134 CAGGGAGCTCAGGGTGGATGAGG + Intronic
1073768364 10:106707993-106708015 CAGGATGTTCATGGTGGCATGGG + Intronic
1073805547 10:107093794-107093816 CAGAGAGATCATGGTGGAAGAGG - Intronic
1075682077 10:124340386-124340408 CAGGGAGATCGTGGTTGCTCTGG - Intergenic
1077050800 11:565912-565934 CAGTGAGCTCCTGGTGGCCCTGG - Intergenic
1077051704 11:569511-569533 CAGGGAGGTCATGGGGCCAGGGG - Intergenic
1077210739 11:1369999-1370021 CATGGGGCTCATGGGGGCAGGGG - Intergenic
1077254286 11:1573452-1573474 CACGGAGCTCAGGGTGCCAATGG + Intergenic
1077437320 11:2549235-2549257 CAGTGGGCTCCTGGTGGCACTGG - Intronic
1077938154 11:6812658-6812680 GAAGGAGCTCATGGTGGGATGGG + Intergenic
1078169579 11:8919271-8919293 CTGGGGGGCCATGGTGGCACTGG + Intronic
1078246046 11:9573923-9573945 CAGGAAGCTCATCGCGGCCCTGG - Exonic
1078523970 11:12086634-12086656 AAGGGGGCTCATGGGGGCAGAGG - Intergenic
1078567801 11:12431731-12431753 TGGGGGGCCCATGGTGGCACTGG - Intronic
1079260285 11:18871979-18872001 CAGCGAGATCATGGTGGTGCTGG - Intergenic
1079322566 11:19463780-19463802 CAGGGAGCACTTGGGGGAACTGG + Intronic
1081805576 11:45888190-45888212 CTGGGAGCTGACAGTGGCACTGG - Intronic
1081879191 11:46433518-46433540 CACAGAGCACATGGTGGCCCAGG - Exonic
1083718086 11:64590687-64590709 CAGAGATCTCAGGGTGGCATTGG + Intronic
1083913798 11:65727024-65727046 CAAGGAGCTGATGTGGGCACCGG - Intergenic
1085051672 11:73383170-73383192 CTGGGAGCTCATGGCTGCCCAGG + Intronic
1085506927 11:77066320-77066342 CCGGGAGCCCATGGCAGCACGGG + Intergenic
1085517030 11:77117624-77117646 CAGGGAGCTGGTGGGGGCAGGGG - Intronic
1088188764 11:107204168-107204190 CAATGAGTTCATGGTGGCATTGG - Intergenic
1089598128 11:119595184-119595206 CAGGGATCTCATGGTCAGACAGG + Intergenic
1090101838 11:123805726-123805748 CAGGGAGCTCAGGATGACAAGGG + Exonic
1092194365 12:6540424-6540446 CAGGGAGCTCAGCGAGGCAGAGG - Exonic
1092306096 12:7302673-7302695 CATTGAGCTCATGGTGGCAGAGG + Intergenic
1094389178 12:29930598-29930620 CAGGGAACTCCTCCTGGCACTGG - Intergenic
1095389886 12:41692994-41693016 CTGGGAGATTCTGGTGGCACAGG + Intergenic
1096526580 12:52213528-52213550 GAGGGACATCATGGTGGCGCTGG - Intergenic
1096786646 12:54020697-54020719 GAGTGGGCTCATGGAGGCACCGG + Intronic
1100512245 12:95286960-95286982 CAGGGAGCTGTTGTTGGCAGGGG + Intronic
1103213892 12:119187105-119187127 CATGGAGCTCAGGGTGGGAGTGG + Intronic
1103600819 12:122053502-122053524 CAGGGAAGTCTTGGTCGCACAGG + Intronic
1104569041 12:129909152-129909174 CAGGGAGAGCATGGTGGGAGGGG + Intergenic
1106070365 13:26405790-26405812 CAGGGAGCTCCTGAGGGCTCAGG - Intergenic
1108562761 13:51662504-51662526 TAGGGACCTCATGAAGGCACAGG + Intronic
1109874986 13:68389897-68389919 CCAGGAGCTCATGGTGGGAGGGG - Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1113092915 13:106633607-106633629 CAAGGAGCTCCTGGAGCCACCGG - Intergenic
1113887979 13:113670899-113670921 CAGGGAGGGCCTGGTGGCTCTGG + Intronic
1116916230 14:50528663-50528685 CAGTGAGCTGATCGTGCCACTGG + Intronic
1118339209 14:64880207-64880229 CAGGGGGCTCGGGGTGGCGCGGG - Intergenic
1120755106 14:88235604-88235626 GAAGGAGCTCATGGCAGCACAGG + Intronic
1121017185 14:90555958-90555980 CAGGGAGCTCATGTGGACCCCGG - Intronic
1121496488 14:94395084-94395106 CAGGGAAGGGATGGTGGCACAGG - Intergenic
1123032276 14:105457538-105457560 CAGGGACCTTCTGGGGGCACAGG - Intronic
1125719984 15:41840648-41840670 CAGGCAGCTCAAGGTGGGCCAGG + Exonic
1126097094 15:45097560-45097582 CAGGGAGCTCAGGATGGGACAGG - Intronic
1126223520 15:46242799-46242821 TAGAGAGCTCCTGGTGGGACAGG + Intergenic
1128248799 15:66150946-66150968 CAGGGTGATCCTGGTGGCAAGGG - Intronic
1128942895 15:71802841-71802863 GAGGAAGCGCAAGGTGGCACCGG + Intronic
1129192672 15:73946625-73946647 CAGAGTGCTCATGGTGGGAGGGG - Intronic
1129403890 15:75301776-75301798 CAGGGTGGCCAGGGTGGCACAGG - Intergenic
1130092062 15:80829380-80829402 CAGGGAGCTAAGGGTGGCAGAGG - Intronic
1132042444 15:98536686-98536708 CAGGCAGGGCATGGTGGCTCAGG + Intergenic
1132501208 16:285477-285499 CAGGGAGTCCATGCTGGCACCGG - Intronic
1133245213 16:4444101-4444123 CAGGGAGTTCATGGTCTCACTGG - Intronic
1134436669 16:14265143-14265165 TGGGGAGCTCATGGTGCCGCTGG + Exonic
1136382365 16:29901470-29901492 CGGGCAGCTCAGGGTGGCCCAGG + Exonic
1137817356 16:51411228-51411250 CAGGGAGCTCTGGCAGGCACTGG - Intergenic
1138415900 16:56871175-56871197 CAGGGTGGGCATGGTGGCTCAGG + Intronic
1139310053 16:66020856-66020878 CAGGGAGGTCATGGGGTCATGGG - Intergenic
1141787173 16:86209328-86209350 CAGGGGCCTAATGGGGGCACTGG + Intergenic
1142032109 16:87843782-87843804 CAGAGAGCCCACGGTGGCAGAGG + Intronic
1143631570 17:8143193-8143215 CAGGCAGCACAGGGTGGCAGAGG + Intronic
1144991885 17:19238414-19238436 CAGGGAGCTCAAGCTGCCCCAGG - Intronic
1147159116 17:38560406-38560428 CAGGGAGCGCATGGAGGCCATGG - Exonic
1148029136 17:44608081-44608103 CAGGGAGCACATGGTGGTCCTGG - Intergenic
1148069885 17:44902520-44902542 TGGGGAGCTGCTGGTGGCACTGG + Exonic
1148466634 17:47868934-47868956 CAGGGCGCTCTGGGTGGCATCGG + Intergenic
1148617603 17:49012989-49013011 CAGAGAGGTCAAGGTGACACTGG - Intronic
1149341467 17:55690772-55690794 CTTGCAGCTTATGGTGGCACAGG + Intergenic
1149996216 17:61407292-61407314 CAGGGGGCTGATGATTGCACTGG - Intronic
1150001583 17:61443800-61443822 CAGGGAGCTCATGCTGGTGATGG + Intergenic
1152120758 17:78416913-78416935 CAGGGAGCCCACGGTGGCTGGGG - Intronic
1152209196 17:78994140-78994162 CAGGCAGCTCTCGGTGGAACGGG - Intronic
1152261488 17:79269650-79269672 CAGGGAGCTGACAGTGGAACAGG - Intronic
1152457400 17:80424112-80424134 CTGGGACCCCATGTTGGCACTGG + Intronic
1153465822 18:5387059-5387081 CATGGAGCACATGGTGGGGCTGG + Intergenic
1153848190 18:9068703-9068725 CATGGAGCTCATCGTGACACTGG + Intergenic
1154042566 18:10871389-10871411 AAGGGAGCTGATGCTGGCAATGG - Exonic
1155645336 18:28070693-28070715 CACAGAGCTCATGGTGTAACTGG + Intronic
1156939048 18:42742661-42742683 TAGGGAGCTCATAGTGTCTCTGG + Intergenic
1158283665 18:55854862-55854884 TAGGGAGCTCACAGAGGCACAGG + Intergenic
1158642332 18:59214196-59214218 CAAGGAGCTGTTGATGGCACAGG + Intergenic
1160364633 18:78313691-78313713 CAGGGAGATCACGGTTGCAGTGG + Intergenic
1160400916 18:78610871-78610893 CATGGAGCTCTTGGTGGCCTCGG - Intergenic
1160720311 19:594285-594307 CTGGGAGCTCTGGGGGGCACAGG + Intronic
1161030659 19:2056430-2056452 GAGGGAGCTCAGGGTTGCCCTGG + Intergenic
1161420939 19:4175640-4175662 CAGGGAGCCCATGGTGGGGCGGG - Intronic
1161476080 19:4486264-4486286 CAGGGAGCTCATGGTCTACCGGG - Intronic
1161528632 19:4773242-4773264 GAGGGAGGTCATGGAGGCAGAGG - Intergenic
1161644730 19:5446044-5446066 GAAGGAGCTCATTGTGGAACAGG - Intergenic
1161698577 19:5783475-5783497 CAGCGAGCTCAAGGTGGCCGAGG - Exonic
1161725099 19:5924034-5924056 CAGGCAGTTCAGGGTGTCACCGG - Intronic
1161769899 19:6225459-6225481 CATGGAGCCCTGGGTGGCACAGG - Intronic
1162971407 19:14183341-14183363 CAGGGGCCTCTTGGTGGCACTGG + Intronic
1163595845 19:18220669-18220691 CAGAGATCTCATGGTCACACAGG - Intronic
1165400578 19:35597085-35597107 CAGGGAGCTTATGGGCGAACAGG + Intergenic
1166455395 19:42936249-42936271 CACGGAGCTCATGCTGTCATGGG - Intronic
1166465184 19:43025532-43025554 CACGGAGCTCATGCTGCCATGGG - Intronic
1166689732 19:44815158-44815180 CAGCTAGCTAATGGTGGAACTGG - Intronic
1167342146 19:48922286-48922308 GAGGGAGGGAATGGTGGCACAGG - Intronic
1167380230 19:49134135-49134157 CAAGGAGCGCATGGGGGCGCTGG + Exonic
1168124379 19:54275599-54275621 CAGGGAGCTCACTGTGGATCAGG - Intronic
1168231993 19:55038499-55038521 CAGGGAGTTTATGGGAGCACGGG - Intergenic
925238339 2:2298683-2298705 CAGGAAGCTGCTGGTGGCACAGG - Intronic
926428199 2:12759162-12759184 CAGGGAGCTTATGGGTCCACTGG - Intergenic
926876211 2:17482363-17482385 CAGGGAGACAATGGTGGCAACGG + Intergenic
927853583 2:26514460-26514482 CAGGGTGCTGATGGGGGCTCTGG - Intronic
928179541 2:29058316-29058338 CAGGGACCTCTTGGGGGCTCAGG + Exonic
929598428 2:43190497-43190519 CAGGGAACTGATGGAGGCAGAGG - Intergenic
930717196 2:54604224-54604246 CAGGGAGTACAGGGTGGAACAGG + Intronic
932330869 2:70897640-70897662 CAGCGAGCTCAGGGAGGCTCGGG + Intergenic
932645827 2:73500541-73500563 CAGTAATCTCATGGTGGCAATGG - Intronic
933193988 2:79368578-79368600 CAGAGAGCCCATGGTGGTTCGGG - Intronic
933998133 2:87684961-87684983 GAGGGAGCTCCAGGTGGAACTGG + Intergenic
934035520 2:88085755-88085777 CAGGGAGCCCAGGGCAGCACTGG - Intronic
935103771 2:100020763-100020785 AAGGGAGCCCATGGTGGCCTGGG - Intronic
935212024 2:100946401-100946423 CAGGGACCTGAAGGTTGCACAGG + Intronic
936295719 2:111265912-111265934 GAGGGAGCTCCAGGTGGAACTGG - Intergenic
938191034 2:129280826-129280848 CAGGGACCCCAAGGTGGCAGAGG - Intergenic
938577312 2:132616678-132616700 CAAGGAGCTCATGCTGGATCAGG - Intronic
939010765 2:136843623-136843645 CAGTGAGCTCAGTGTGGTACTGG + Intronic
939715836 2:145582765-145582787 CAGGGCTATCATGGTGGCATTGG + Intergenic
943201070 2:184824795-184824817 CTAGGAGCTCATGCTGGGACTGG + Intronic
944763582 2:202841663-202841685 CAAGGAGCTGATGCAGGCACCGG + Intronic
945186211 2:207142465-207142487 CAAGGTGCTCATGGTATCACAGG + Intronic
947998368 2:234547420-234547442 CAGGGAGATGATGGGGGCAGTGG + Intergenic
948020953 2:234732833-234732855 CAGGGAGCTCATGGAGACCTAGG - Intergenic
948070100 2:235114075-235114097 CAGGGAGCTGATGGAGGGATGGG + Intergenic
1168864966 20:1078479-1078501 CAGGCATTTCAAGGTGGCACAGG + Intergenic
1171205148 20:23273297-23273319 GAGGGGCCTCATGTTGGCACTGG - Intergenic
1173982358 20:47234401-47234423 CAGGGAACTGAGGGTGGCCCAGG + Intronic
1174713038 20:52727569-52727591 CAGTGAGCTCGTGGTCTCACCGG + Intergenic
1174776001 20:53343596-53343618 CATAAAGCTCATGGTAGCACTGG - Intronic
1174872470 20:54195824-54195846 CAGGGAGTTCATGGTGGGAAGGG - Intergenic
1176171522 20:63698443-63698465 CACGGAGCTCCTGGGGGCGCAGG + Exonic
1176201381 20:63862301-63862323 CGGGTAGGTCATGGTGGCCCAGG - Exonic
1176665680 21:9685406-9685428 AAGAGAGCTCGTGGTGGCCCTGG + Intergenic
1176864546 21:14038337-14038359 TAGAGAGCTCCTGGTGGGACAGG + Intergenic
1179288019 21:39994886-39994908 CAGAGAGCTCAGGGTGACCCTGG + Intergenic
1179377536 21:40864223-40864245 CTGGGAGCTGAGGCTGGCACTGG - Intergenic
1180926830 22:19561029-19561051 CAGGGAGCCGATCGGGGCACTGG + Intergenic
1183070242 22:35391051-35391073 CAGGTAGGTTAGGGTGGCACAGG - Intronic
1183403121 22:37616516-37616538 CTGGGAACTCAAGGTGGCAAAGG - Intronic
1184466485 22:44671399-44671421 TGGGGAGCACGTGGTGGCACGGG + Intronic
1185287586 22:50009461-50009483 CCGAGAGCACAGGGTGGCACTGG + Intronic
949508582 3:4749070-4749092 CAGGGAGCTGTTGTTGGGACAGG - Intronic
951538937 3:23764321-23764343 CAGGGATCTCATAGTTCCACAGG + Intergenic
954132382 3:48567251-48567273 CAGGGAGCTCATGGGAGTTCAGG - Intronic
954201017 3:49023063-49023085 CAGGAAGTTGAAGGTGGCACAGG - Exonic
954217237 3:49131452-49131474 CAGGGAGTTCATAGTCACACTGG + Intronic
954302065 3:49705397-49705419 CGGGGAGCCCATGGGGGCATGGG - Intronic
955355760 3:58231028-58231050 CAGGCAGGACATGGTGGCTCAGG + Intergenic
959810151 3:110608467-110608489 CATGGAGCTAATGGTTTCACTGG + Intergenic
961008965 3:123423614-123423636 CAGGGAGCTCTTGAGGGCAGGGG - Intronic
961165968 3:124764157-124764179 CAGGAAGGTCATGGGGGCAGAGG - Intronic
961390701 3:126550814-126550836 CAGGGAGCTGAAGGGGGCAGTGG - Intronic
961475561 3:127144297-127144319 CAGGGAGATCATTGTGGAAGGGG - Intergenic
961544514 3:127623100-127623122 CAGGCTGAGCATGGTGGCACAGG - Intergenic
962141177 3:132792260-132792282 CAGGAACCTCATGGTAGCAAAGG - Intergenic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
969059905 4:4426222-4426244 CAGGAAGCTCAGGGTGACACGGG - Intronic
981046150 4:140267196-140267218 CAGTGAGCTAAAGGTAGCACTGG + Intronic
981123389 4:141078174-141078196 CAGGCATCTCTTGGTTGCACTGG - Intronic
983047755 4:163007053-163007075 CAGGGAGGTCACGGTGCCATTGG + Intergenic
984545600 4:181098448-181098470 TAGAGTGCTAATGGTGGCACTGG - Intergenic
985411402 4:189689670-189689692 AAGAGAGCTCGTGGTGGCCCTGG + Intergenic
985585896 5:733883-733905 GGGGGGGCTCAGGGTGGCACTGG + Intronic
985599561 5:819655-819677 TAGGGCGCTCAGGATGGCACTGG + Intronic
985816560 5:2132195-2132217 CAGGGAGGGCCTGGTGCCACTGG + Intergenic
985922257 5:2986563-2986585 CATGGAGCCCTTGGTGGCCCAGG + Intergenic
986336127 5:6757201-6757223 CAGGGAGATTATGTTGTCACTGG + Intergenic
986573917 5:9192964-9192986 CAGGGAGTTCTCGGTGGCAGGGG + Intronic
989147645 5:38264582-38264604 CAGGTAGATCAAGGTGGCACTGG - Intronic
992483093 5:77170344-77170366 TAAGGAGCTCATGGTCTCACTGG + Intergenic
994320944 5:98393422-98393444 CAAGGAGCTGATGCGGGCACTGG + Intergenic
995360254 5:111289021-111289043 TAGGAAGCTCATGGTGGGAGAGG + Intronic
995571777 5:113488656-113488678 CAGGGAGCTAAGGGTGGCAACGG + Exonic
996234257 5:121107458-121107480 CAGGGAGCCCATGGAGGGAGTGG - Intergenic
997282615 5:132658315-132658337 CAGGGAGCTCATTGAGGAGCTGG + Exonic
998164700 5:139836375-139836397 CAGGGCTCTCATGGGGGCCCAGG + Intronic
999873433 5:155775810-155775832 CAGGGAGCTTATGATGCTACAGG + Intergenic
1000063350 5:157675063-157675085 CAGGGAGGGAAAGGTGGCACAGG - Intronic
1001796831 5:174509493-174509515 AAGGGAGCTCCAGGTGGCAGTGG - Intergenic
1002979562 6:2122613-2122635 GAGGAATCTGATGGTGGCACAGG - Intronic
1004865835 6:19853214-19853236 CAGGGACGTCAGGGTAGCACAGG - Intergenic
1005822211 6:29607321-29607343 CAGGGAGCTCATGGTGGCACAGG + Intronic
1005880526 6:30055597-30055619 CAGAAAGCTAATGGTGGGACTGG + Intergenic
1006879541 6:37327118-37327140 CAGGGAGTACATGGTGGCATGGG + Intronic
1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG + Intronic
1009935954 6:70234819-70234841 CAGGGAGAACAGGGTGCCACCGG - Exonic
1016014243 6:139167209-139167231 CCGGGAGCGCCCGGTGGCACAGG - Exonic
1018694127 6:166377269-166377291 CAAGGAGCTGATGTGGGCACTGG + Intronic
1019352048 7:558954-558976 CAGGGAGAACCTGGTGCCACAGG + Intronic
1019918610 7:4149278-4149300 CAGAGAGCTCCTGGTGCCCCAGG + Exonic
1020280411 7:6647361-6647383 CAGGGGGATGAGGGTGGCACTGG - Intronic
1020686660 7:11304591-11304613 CAGGGAGGGCAGGGTGGCCCAGG + Intergenic
1023929612 7:44697370-44697392 CATGGAGCACATGGTGGCGGTGG - Exonic
1024211210 7:47207071-47207093 CAGGGAGCTCAAGGCTGCAGTGG + Intergenic
1024654036 7:51434185-51434207 CAGGGAGGTCATGGGGCCAATGG - Intergenic
1025214333 7:57043223-57043245 CAGGGAGAAACTGGTGGCACAGG - Intergenic
1025595443 7:62918338-62918360 CTGGGAGCTCATTGAGGCCCAGG + Intergenic
1025657620 7:63533590-63533612 CAGGGAGAAACTGGTGGCACAGG + Intergenic
1026231420 7:68487440-68487462 CTGTGAGCTCATGGGGGCAGAGG + Intergenic
1027876979 7:83783208-83783230 CAGGACTCTCTTGGTGGCACAGG + Intergenic
1029684008 7:102133022-102133044 CAGGGAGATACTGGTGGCAGAGG - Intronic
1032953066 7:136938626-136938648 CGAGGAGCTCATGCGGGCACAGG + Intronic
1032997391 7:137463254-137463276 CAAGGGGCTCAAGGTGGCTCAGG + Intronic
1033049034 7:137987577-137987599 CAGGATGCTGATGGTGGGACAGG + Intronic
1033373891 7:140738516-140738538 TAGGGAGCTCCTGATAGCACTGG - Intronic
1034397212 7:150836226-150836248 CAGGGAGACATTGGTGGCACAGG + Intronic
1034591184 7:152140752-152140774 CCGGGAGCACATGGTGGGAAGGG + Intronic
1035746034 8:1962613-1962635 CAGGGAGCTGACGGAGCCACTGG - Intergenic
1036618267 8:10405006-10405028 GAGGGAGCACAGGGTGGCCCAGG - Intronic
1041032728 8:53754708-53754730 CAGGGTGCTCATTGTGCCCCTGG + Intronic
1044731212 8:95229940-95229962 CAGGCTACTCATGGTGGCCCAGG - Intergenic
1047456413 8:125017203-125017225 CAGTGAGCTCCTGGGGGCCCAGG + Intronic
1048194530 8:132321491-132321513 CAGGAGGGCCATGGTGGCACAGG - Intronic
1049047822 8:140166452-140166474 CAGGGAGCTCAAGCTCCCACAGG + Intronic
1049090349 8:140509965-140509987 CAGGGAGCACATTTTGGCAGAGG - Intergenic
1049263396 8:141652082-141652104 CAGGGGACTCATCGTAGCACCGG + Intergenic
1049483733 8:142840487-142840509 CTGAGCGCGCATGGTGGCACTGG - Exonic
1049796552 8:144499779-144499801 CAGGGAGCACAGGGTGGCGGGGG - Intronic
1050877070 9:10651723-10651745 CAGGCAGCACATACTGGCACCGG - Intergenic
1052774437 9:32719424-32719446 CAGGAAGCTCATGGTGTAATAGG - Intergenic
1055559883 9:77511962-77511984 TACGGAGCCCATGGCGGCACAGG - Intronic
1057626913 9:96686179-96686201 CAGGAAGCTCTTTGTGGCTCAGG + Intergenic
1057803176 9:98202214-98202236 CAGGGTGCTCCTGGCGACACTGG + Intronic
1060897777 9:127229335-127229357 CAGAAAGTTCAGGGTGGCACTGG + Intronic
1061401497 9:130370777-130370799 GAGGGAGCCCATGGCGCCACAGG - Intronic
1203660423 Un_KI270753v1:36355-36377 AAGAGAGCTCGTGGTGGCCCTGG - Intergenic
1203671194 Un_KI270755v1:13312-13334 AAGAGAGCTCGTGGTGGCCCTGG - Intergenic
1190641507 X:52484945-52484967 GAAGGAGCTCCTGGCGGCACTGG + Intergenic
1190646165 X:52527920-52527942 GAAGGAGCTCCTGGCGGCACTGG - Intergenic
1191220628 X:57984771-57984793 CAAGGAGCTGATGTGGGCACTGG - Intergenic
1191253887 X:58271588-58271610 CAGGGAGGTCATGTAGTCACTGG - Intergenic
1191832432 X:65429929-65429951 GAGGGAGCTCCTGGTGGGAGAGG - Intronic
1192233474 X:69281534-69281556 CGGGGAGCACATGCAGGCACTGG + Intergenic
1194312412 X:92328274-92328296 CAGGGAGGTCAAGGTGGCTAGGG + Intronic
1199360042 X:146907251-146907273 CAGGGAGCTCCTGATGGCTGGGG - Intergenic
1199527227 X:148806110-148806132 AAGAGAGCTAGTGGTGGCACTGG - Intronic
1200070167 X:153525339-153525361 CAGGGGTGTGATGGTGGCACAGG + Intronic
1200620679 Y:5442405-5442427 CAGGGAGGTCAAGGTGGCTAGGG + Intronic