ID: 1005822297

View in Genome Browser
Species Human (GRCh38)
Location 6:29607891-29607913
Sequence CAGTGAGGCCAGAGTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 538}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005822297_1005822303 19 Left 1005822297 6:29607891-29607913 CCAGCTGCACTCTGGCCTCACTG 0: 1
1: 0
2: 3
3: 54
4: 538
Right 1005822303 6:29607933-29607955 GAACTGCATGTGCATGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005822297 Original CRISPR CAGTGAGGCCAGAGTGCAGC TGG (reversed) Intronic
900185349 1:1330797-1330819 CAGTCAGGCCAGTGGGCAGCCGG - Intergenic
900432402 1:2609129-2609151 GAGTGAGGCCGCAGGGCAGCTGG + Intronic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901217177 1:7561359-7561381 CAGAGAGGCCGGCGGGCAGCAGG + Intronic
901539009 1:9902609-9902631 CACTGGGGCCAGTGTGCATCTGG + Intronic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
904033109 1:27545421-27545443 CAGTGAGGCCTGAACGCAGGAGG - Intronic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
905180066 1:36160114-36160136 AAGTTAGGCCACAGGGCAGCTGG + Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
906065407 1:42977009-42977031 CACTGGGGCCAGATTGCAGAGGG + Intergenic
906201414 1:43962901-43962923 GAATGAGGCCAGAATACAGCAGG + Intronic
906266673 1:44436282-44436304 CTGGGAGGACAGAGTGGAGCTGG + Intronic
907527654 1:55063261-55063283 CTGTGAGGCCAAAGTGCAGACGG - Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910762841 1:90751901-90751923 CTGTGGCGCCAGAGTGGAGCAGG - Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
913220290 1:116654564-116654586 CAGGGAGGCCACACTGCAGGAGG + Intronic
914947731 1:152081029-152081051 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
915605402 1:156947232-156947254 CAGTGGGGCCAAAGTGGAACAGG + Intronic
915608264 1:156969183-156969205 CACAGAGGCCTCAGTGCAGCTGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
918308753 1:183270476-183270498 CAGTAAGGTCAGAGTCCAGCAGG + Intronic
918445811 1:184615701-184615723 CAGTAGGGCCAGTGTGCAGATGG + Intronic
919148164 1:193661084-193661106 AAATGAGGCCAGAATGCAGATGG - Intergenic
919436119 1:197563324-197563346 CAGTTAGGCGATAATGCAGCTGG + Intronic
920529305 1:206690314-206690336 CACTGAGGCAAGATTGAAGCTGG + Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
921338080 1:214108006-214108028 CAATGAGGCCTGTGTGCAGTGGG - Intergenic
921346576 1:214191814-214191836 CACCCAGGCTAGAGTGCAGCAGG - Intergenic
921546699 1:216482421-216482443 CAGTGAGGACAGGGTCCAGGTGG - Intergenic
921683328 1:218060419-218060441 GAGTGAGGCCAACGTGTAGCTGG + Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922532614 1:226356021-226356043 CAGTGAGAGCACAGTGCACCCGG + Intergenic
922604504 1:226881087-226881109 AAGTGAGGGCAGAGTCCAGAAGG - Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923775184 1:236971635-236971657 CAAGGAGGCCAGAGTGCTGGGGG - Intergenic
1063827141 10:9910801-9910823 CAGTGAGGCTAGAATAAAGCAGG - Intergenic
1064222485 10:13454033-13454055 CAAGGAGCCCAGAGAGCAGCAGG + Intronic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1064332143 10:14403912-14403934 CAGTGAGGCCTGGCTGCAGGAGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1065365751 10:24935420-24935442 CTCTCAGGCCAGAGTGAAGCTGG - Intronic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066026572 10:31364270-31364292 CCCTGAGGCTAGAGTCCAGCTGG - Intronic
1067055356 10:43046666-43046688 CAGTGAAGCCACTGTGCTGCGGG + Intergenic
1068779724 10:60906548-60906570 CAGCCAGGACAGAGTGCAGCTGG - Intronic
1068900808 10:62268174-62268196 CAGCGAGGCCAGTGGACAGCTGG - Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069917346 10:71795772-71795794 CAGTTAGTTCAGGGTGCAGCAGG - Exonic
1069931109 10:71882309-71882331 CAGTGAGCCGAGATTGCACCTGG - Intergenic
1069993528 10:72329105-72329127 AAGTGGGGCCAGAATGGAGCTGG - Intergenic
1069997822 10:72353998-72354020 CAGGGAGGGAAGAGTGAAGCTGG - Intronic
1070007798 10:72442198-72442220 CAGTGAGCCAAGATTGCACCTGG - Intronic
1070642692 10:78180800-78180822 AGGTGAGGCCAGAGACCAGCAGG - Intergenic
1070781159 10:79138142-79138164 CAGTGAGGCCCCAGTGCTGCGGG + Intronic
1070976288 10:80608525-80608547 CAGTGTAGCCCGAGTGCAGGGGG + Intronic
1071363461 10:84875317-84875339 CAGTGGGGCCAGAAAGCAGTGGG - Intergenic
1071896296 10:90071079-90071101 CATTCAGGCTGGAGTGCAGCTGG + Intergenic
1072218937 10:93311284-93311306 CAGTGAGGCCAAAGTGAAAGTGG + Intronic
1072425362 10:95325607-95325629 CAGTGAGCCCAGATTGCGCCTGG - Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073101034 10:101006823-101006845 TGATGAGGCCAAAGTGCAGCGGG + Exonic
1075153434 10:119955402-119955424 GGCTGAGGCCAGAGTGCAGTGGG + Intergenic
1075168508 10:120091458-120091480 CTGTCTGGCCAGTGTGCAGCTGG + Intergenic
1075283322 10:121160385-121160407 CAGTTTGGCCAGAGCTCAGCAGG - Intergenic
1075469044 10:122673993-122674015 CAGTGAGGCCTTAGGGCAACTGG + Intergenic
1076238413 10:128883616-128883638 CAGTGAGGCCAGCTGGCAGCGGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076544953 10:131238947-131238969 CAGGGAGGCAGGAGAGCAGCAGG - Intronic
1077134447 11:991567-991589 CAGTGAGGCCTGAGGGCCCCTGG + Intronic
1077897366 11:6463591-6463613 CAGGGAGGCCAGGACGCAGCTGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078386647 11:10898808-10898830 CATTGAGGTCAGAGTGGAGGAGG - Intergenic
1079252224 11:18794608-18794630 CTGTGAGGCCCCAGTGCACCTGG - Intergenic
1079591800 11:22191945-22191967 CACTTAGGCTGGAGTGCAGCGGG + Intergenic
1079616980 11:22507090-22507112 TAGTGAGCCCAGATTGCACCTGG - Intergenic
1079748517 11:24164079-24164101 GAGTGGGGCCAGATTGCAGAGGG - Intergenic
1081962804 11:47150767-47150789 TAGTGTGGCCAGAATGCAGTGGG + Intronic
1082260349 11:50073007-50073029 CAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1083152909 11:60804304-60804326 CAGCAAGCCCAGCGTGCAGCAGG + Intergenic
1083174131 11:60938793-60938815 AAGTCAGGGCAGAGTGCAGTGGG - Intronic
1083623986 11:64062673-64062695 CAGGGAAGCCAGAGTGCTGAAGG + Intronic
1083848888 11:65354109-65354131 CAGCGAGGCTGGAGAGCAGCTGG + Intergenic
1084116323 11:67044937-67044959 CTGTGAGGGCAGAGTGAAGGGGG + Intronic
1084273549 11:68040941-68040963 GAGGGAGGCCAGAGTGAAGGTGG + Intronic
1084315624 11:68343728-68343750 CACTGAGGCCTGAGGGCAGGAGG - Intronic
1084462114 11:69301970-69301992 CAGTGAGGTCAGAGGGCTCCCGG - Intronic
1084556449 11:69878953-69878975 CAGAGAACCCAGAGTTCAGCAGG + Intergenic
1085128671 11:74019203-74019225 CTCTGAGGCCAGAGTCCAGGAGG - Intronic
1085294327 11:75422410-75422432 CAGGCAGGGCAGACTGCAGCTGG + Exonic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086037703 11:82436717-82436739 CACTCAGGCTAGAGTGCAGTGGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1088440701 11:109867197-109867219 CAGTCAGGCATGAGGGCAGCAGG + Intergenic
1088541562 11:110919025-110919047 AACTGAGGCCAGAGAGAAGCTGG + Intergenic
1088688297 11:112303650-112303672 CAGTGAGGCCCTAGTGCCCCTGG + Intergenic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1089632433 11:119792056-119792078 CAGGGAGGGCAGAGTGGGGCTGG + Intergenic
1090581146 11:128160405-128160427 TAGTGATGCCAGAATGTAGCAGG + Intergenic
1090785621 11:130044810-130044832 CAGTGAGCCGAGATGGCAGCAGG + Intergenic
1090825703 11:130384118-130384140 CAGACAGGCCAGAGTGCACATGG + Intergenic
1093699855 12:22207112-22207134 CAGATAGGCCAATGTGCAGCAGG + Intronic
1093930762 12:24953016-24953038 CAGTGAGGACAAAATGAAGCTGG - Intergenic
1094001316 12:25697984-25698006 AGGTGAGGACTGAGTGCAGCAGG + Intergenic
1094042662 12:26133861-26133883 CAATGAGGACAGAGTGGAGAAGG + Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095878569 12:47107579-47107601 CAGAGAGGCCAGACTCCAGCAGG + Intronic
1096700977 12:53382520-53382542 CACTGGGGCCCAAGTGCAGCAGG + Exonic
1096872493 12:54602215-54602237 CAGAGAGGTCAGAGTGCTGTGGG + Intergenic
1098039678 12:66341330-66341352 CAGTGAGGCTAGAACACAGCAGG - Exonic
1098042013 12:66361982-66362004 CAGTTAGCCCTGAGTGCAGTGGG - Intronic
1098899534 12:76098867-76098889 CAGTGAGCCAAGATTGCACCTGG - Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1101968603 12:109296993-109297015 CACTGAGGCCAGAGAGGAACAGG + Intronic
1102146428 12:110658330-110658352 CAGTGAGGCCACACTGGAGTAGG - Intronic
1102465999 12:113131175-113131197 CAGGGAGGCCTGAGGCCAGCAGG + Intronic
1103749958 12:123151488-123151510 CAGGGAGGGCAGAGCGCAGCGGG + Intergenic
1104040156 12:125124690-125124712 CAGTGATGCTAGGGTGCAGGCGG - Exonic
1104228628 12:126861874-126861896 CAGTGAGCCGAGATTGCACCTGG - Intergenic
1104261052 12:127182385-127182407 CAGTGTGGCTAGAATACAGCAGG - Intergenic
1104519558 12:129460907-129460929 CAGAGAAGCCAAAGTGCATCTGG + Intronic
1104602719 12:130163862-130163884 CAGGAAGACCAGCGTGCAGCCGG - Exonic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104676235 12:130714327-130714349 AGGTGAGGCCAGCGTGCAGCCGG - Intronic
1104918004 12:132276027-132276049 CAGTGAATCCACATTGCAGCAGG + Intronic
1105242927 13:18623699-18623721 CAGTGAGGACAGAGTTCATGTGG - Intergenic
1105715424 13:23057781-23057803 CAGTGAGTCAAGATTGCACCTGG + Intergenic
1105890172 13:24677040-24677062 CATAGAGGCCAGGCTGCAGCCGG - Intergenic
1105968158 13:25403531-25403553 CAGTGAGGTCCCAGTGAAGCTGG - Intronic
1107104353 13:36627199-36627221 CAGAGAAGCCAAAGGGCAGCAGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110626933 13:77662847-77662869 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
1112130112 13:96514209-96514231 CAGTGATACCAGCGTGCAGTAGG + Intronic
1112251496 13:97784730-97784752 CAGTGTGGCCTGGGTTCAGCAGG - Intergenic
1112326141 13:98443894-98443916 CAGTGAGGCCAGGGAGTGGCGGG + Intronic
1113424210 13:110194533-110194555 CCGAGAGCCCAGAGTGAAGCTGG + Intronic
1113741440 13:112714744-112714766 CAGTGAGGCCACTGTGGATCAGG + Intronic
1113797571 13:113067224-113067246 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797582 13:113067290-113067312 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797592 13:113067356-113067378 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797602 13:113067422-113067444 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797613 13:113067488-113067510 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797623 13:113067554-113067576 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797633 13:113067620-113067642 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797644 13:113067686-113067708 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797655 13:113067752-113067774 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797666 13:113067818-113067840 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797677 13:113067884-113067906 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797687 13:113067950-113067972 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797697 13:113068016-113068038 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797708 13:113068082-113068104 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797719 13:113068148-113068170 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797729 13:113068214-113068236 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797740 13:113068280-113068302 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797750 13:113068346-113068368 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797760 13:113068412-113068434 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797770 13:113068478-113068500 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797781 13:113068544-113068566 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797792 13:113068610-113068632 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797802 13:113068676-113068698 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797813 13:113068742-113068764 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797823 13:113068808-113068830 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797833 13:113068874-113068896 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797844 13:113068940-113068962 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797855 13:113069006-113069028 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797865 13:113069072-113069094 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797875 13:113069138-113069160 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797886 13:113069204-113069226 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797896 13:113069270-113069292 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797906 13:113069336-113069358 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797916 13:113069402-113069424 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797927 13:113069468-113069490 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797938 13:113069534-113069556 CAGTGAGCCGAGATTGCACCTGG + Intronic
1113797949 13:113069600-113069622 CAGTGAGCCGAGATTGCACCTGG + Intronic
1119533391 14:75379599-75379621 TAGTGAGGGCAGAGTCCTGCGGG - Intergenic
1120379133 14:83750741-83750763 CACTCAGGCTAGAGTGCAGTGGG - Intergenic
1121102802 14:91261638-91261660 CTGTGGGGCCAGGGTGGAGCCGG + Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121307952 14:92918626-92918648 CAGAGAGGCCGGAGTGTGGCAGG + Intergenic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122362896 14:101177884-101177906 CACTGAGGCCAGAGAGGGGCAGG + Intergenic
1122693472 14:103542189-103542211 CAGTGAGGCCAGCGAGGAACGGG - Intergenic
1122998984 14:105281802-105281824 AAGTGAAGCCAGTGGGCAGCAGG + Intronic
1123407338 15:20028972-20028994 CACTGAGGCCAGAAGTCAGCAGG + Intergenic
1123516665 15:21035628-21035650 CACTGAGGCCAGAAGTCAGCAGG + Intergenic
1124973043 15:34508644-34508666 CACCCAGGCCAGAGTGCAGTAGG - Intergenic
1125841817 15:42808808-42808830 CAGCAAGGCTAGAGTGCAGTTGG - Intronic
1125936739 15:43643393-43643415 CAGTGAGCCGAGATGGCAGCTGG - Intronic
1125967453 15:43885926-43885948 CACTGAGGCAGGAGAGCAGCTGG - Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127078505 15:55351812-55351834 CAGTGAGCCGAGATTGCACCAGG + Intronic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1128607840 15:69050446-69050468 CAGTGAGCCGAGATTGCACCTGG - Intronic
1129766892 15:78175416-78175438 CAAGGAGCCCACAGTGCAGCGGG + Intronic
1130235986 15:82133940-82133962 CACTGAGGCCAGAGTGAACGTGG + Intronic
1130322799 15:82854605-82854627 CAGTGAGCCCCGAGGCCAGCTGG - Intronic
1130861501 15:87894825-87894847 CAGTGAGGAGAGAGTAGAGCAGG - Intronic
1132095425 15:98980890-98980912 CACTGAGGCTAGTGTGCAGTGGG - Intronic
1132244629 15:100284866-100284888 CAGAGAGGTCAAAGTGCAGGTGG + Intronic
1132847157 16:2005917-2005939 CTCTGAGGCCAGGGAGCAGCTGG + Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133328636 16:4957852-4957874 CAGTCAGACCCAAGTGCAGCGGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134684585 16:16149848-16149870 AGGTGAGTCCAGAGTACAGCGGG + Exonic
1134795695 16:17034655-17034677 CAGTGGGGGCAGGGTTCAGCAGG + Intergenic
1136390839 16:29963221-29963243 CAGAGAGGCCAAGGAGCAGCAGG - Exonic
1137523992 16:49217788-49217810 CAGTGAGGCTAGAATAAAGCAGG - Intergenic
1138431735 16:56973223-56973245 CATTCAGCCCAGAGTGCAGATGG - Intronic
1138725610 16:59135400-59135422 CATTCAGGCCAGAGTGCAGGGGG - Intergenic
1139357769 16:66377456-66377478 CAGTGGGCCCAGAGGTCAGCTGG + Intronic
1139495049 16:67310368-67310390 CAGCAAAGCCAGAGGGCAGCTGG - Intronic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1139964474 16:70737898-70737920 GAGGGAGGCCGGAGTGGAGCAGG - Intronic
1140196489 16:72859731-72859753 CAGTGAGGGGAGAATGCGGCAGG + Intronic
1141558828 16:84853547-84853569 CGGTGAGGCCAGGGTGCTTCTGG + Intronic
1142308868 16:89300475-89300497 CAGAGAGAGCAGAGTGCAGCAGG - Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142848689 17:2694123-2694145 CGGGCAGGCCAAAGTGCAGCAGG - Exonic
1143173438 17:4943323-4943345 CTGTGAGGCCAGACTGGATCTGG + Intronic
1143176718 17:4959739-4959761 TGGTGAGGCCACAGTGCGGCTGG - Exonic
1143329335 17:6121939-6121961 CACAGAGGCCAGTGTGCAACCGG - Exonic
1143490881 17:7284648-7284670 CATTGATGCCAGAGAGCTGCTGG - Exonic
1143729911 17:8875596-8875618 CAGGGAGGCCAGGGAGGAGCAGG - Intergenic
1143887431 17:10075752-10075774 CACCCAGGCCAGAGTGCAGGGGG - Intronic
1143907982 17:10225086-10225108 CAGGGATGCCAGTCTGCAGCTGG + Intergenic
1144653589 17:17021672-17021694 CAGTAAGTCCATAGTACAGCTGG - Intergenic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145782360 17:27571487-27571509 CTCTGAGGCCAGAGCCCAGCGGG - Intronic
1145985653 17:29044306-29044328 AAGTGAGGTGAGATTGCAGCAGG + Intronic
1146553168 17:33799594-33799616 CAGTGATCCCAGTGTGCACCTGG + Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1149698123 17:58633078-58633100 CTGTAAGGCCAGAGTGTGGCTGG - Intronic
1150254099 17:63730347-63730369 CAGTTAGTCCAGATTGTAGCAGG - Intronic
1151483310 17:74383206-74383228 CAGGGAGGCCAGGGAGCAGCTGG + Intergenic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1151665932 17:75545153-75545175 GAGTGAGGCTAGGGTGGAGCTGG + Intronic
1151821175 17:76497717-76497739 TAGTGAGCCCACTGTGCAGCTGG + Intronic
1151991053 17:77574532-77574554 GAGAGAGGACAGAGTGGAGCAGG - Intergenic
1152091638 17:78250729-78250751 CAGCCAGTCCAGAGTGCAGTGGG + Intergenic
1152528571 17:80903484-80903506 CAATGATGCCGCAGTGCAGCCGG - Intronic
1152584733 17:81183830-81183852 CTGTGTGGCCAGTGAGCAGCTGG - Intergenic
1153226648 18:2905642-2905664 TAGTGAGGCTGGAGTGCAGCGGG + Intronic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153717063 18:7860448-7860470 CAGTGAGGGAAGAGTGCAGGGGG + Intronic
1154001698 18:10487307-10487329 CACTGAGCCCAGAATACAGCTGG - Intronic
1154158012 18:11959118-11959140 CAGTGAGCCGAGATGGCAGCAGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155145447 18:23079650-23079672 CACTCAGGCTAGAGTGCAGTGGG + Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1159766004 18:72489223-72489245 CAGAGAGGCCAGAGTGTGGGGGG + Intergenic
1159900997 18:74045494-74045516 CAGAGAGGCCAATGGGCAGCTGG - Intergenic
1160098690 18:75900838-75900860 AAGTGAGGCCTGAGGGCAGTGGG - Intergenic
1160141272 18:76325349-76325371 CATGGAGCCCAGAGTGCAGGAGG - Intergenic
1160561258 18:79757495-79757517 CAGTGAGGACATAGAGCAACAGG - Intergenic
1160875068 19:1293107-1293129 AACTGAGGCCAGAGGGCAGTGGG + Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161486239 19:4537342-4537364 CAGTGTGGCCAGGGCTCAGCTGG + Exonic
1162028231 19:7906068-7906090 CAGGGAGTCCAAAGTGGAGCTGG - Intronic
1162098231 19:8323690-8323712 CACCGAGGCTAGAGTGCAGTGGG - Intronic
1162176567 19:8833928-8833950 AAGTGAGCCGAGATTGCAGCCGG + Intronic
1162795572 19:13085779-13085801 CAGAGAAGCCAGAGTTCAGAAGG + Intronic
1163855538 19:19698959-19698981 CAGTGAGCCGAGATCGCAGCTGG - Intergenic
1165460896 19:35943809-35943831 CAGGGAGGCTAGAGCGGAGCTGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166195968 19:41206172-41206194 CAGTAAGCCCAGGGTGCAGAAGG - Intronic
1166694786 19:44846385-44846407 CAGGGAGGCTAGAGCGCAGCGGG + Intronic
1167119054 19:47505917-47505939 GAGGGAAGACAGAGTGCAGCAGG - Intronic
1167299931 19:48672447-48672469 CAGTGAGGCCAGGCTGGGGCAGG - Intronic
1167405187 19:49302044-49302066 CTCTGTGGCCAGACTGCAGCAGG + Intronic
1168021371 19:53611306-53611328 CACTCAGGCTGGAGTGCAGCAGG + Intergenic
1168288160 19:55344677-55344699 CAGGGAGGCCAGAGAGCCCCAGG + Intronic
925081325 2:1070025-1070047 CAGTGACGTCAGTGTGCAGGGGG + Intronic
925154179 2:1637536-1637558 CAGAGTGGACAGCGTGCAGCAGG - Intronic
925185625 2:1844249-1844271 CAGTGAGAACAGGGTGCTGCGGG - Intronic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926921908 2:17947251-17947273 CAGTGGGGCCTGAGTGAGGCTGG + Intronic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
928377211 2:30785192-30785214 CAGTGGGGGGAAAGTGCAGCAGG + Intronic
928876045 2:36041474-36041496 AAGTGTGGCAAGAGGGCAGCTGG - Intergenic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930312180 2:49755747-49755769 CAGTCAGGCTAGAGTACAGTAGG - Intergenic
931007227 2:57865576-57865598 CAGTGATGCCAGGGTGGTGCTGG + Intergenic
931190314 2:59994033-59994055 CTGTAAGTCCAGAGTGGAGCAGG - Intergenic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931669729 2:64636467-64636489 CAGTGAGGCCGGGGTGAGGCAGG + Exonic
932063493 2:68529685-68529707 CCCTGAGGCTAGAGTCCAGCTGG - Intronic
932214426 2:69957775-69957797 CAGTGGTCCCAAAGTGCAGCAGG - Intergenic
932337976 2:70941911-70941933 CACTGAAGCCAGAGTGGAGAAGG + Exonic
933584041 2:84160805-84160827 CAGTCTGTCCAGGGTGCAGCTGG + Intergenic
933704085 2:85277040-85277062 CAGTGAGGACTCTGTGCAGCTGG + Intronic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935707566 2:105870176-105870198 CAGTGAGACCACAGTGCCACGGG + Intronic
936092867 2:109512202-109512224 CAGTGGGGCCAGGGCCCAGCAGG - Intergenic
937397843 2:121554172-121554194 CGCTCAGGCCAGAGTGCAGTGGG - Intronic
938732407 2:134156848-134156870 TGGTGTGGCCAGAGTGCAACTGG + Intronic
938884005 2:135624535-135624557 CAGTGAGTGCAGAGTGCTGCTGG + Intronic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
940232629 2:151473332-151473354 CACCCAGGCCAGAGTGCAGGTGG + Intronic
941694673 2:168538297-168538319 AAGTGGGGTCAGAGAGCAGCAGG - Intronic
942311503 2:174661154-174661176 CAGGGAGGCCAGCGTGCAGCAGG + Intronic
944560002 2:200927139-200927161 CAGTGAGCCAAGAGTGCCACTGG - Intronic
944863497 2:203838383-203838405 CAGTAAGTCAAGAGTGCAGTTGG - Intergenic
945110811 2:206357684-206357706 CAGTGAGCCGAGATGGCAGCAGG + Intergenic
945566500 2:211407037-211407059 CACTCAGGCCAGAGTACAGTGGG - Intronic
945613632 2:212038419-212038441 CAGTAAAGGTAGAGTGCAGCTGG - Intronic
946024247 2:216662217-216662239 AAGTGAGGCCGGTGGGCAGCTGG - Intronic
946041942 2:216790328-216790350 AAGGGAGGGCAGAGTGCAGCTGG + Intergenic
946489504 2:220133967-220133989 CAGTGAGGTTAGAGTCTAGCAGG - Intergenic
946523915 2:220497286-220497308 CAGTGAGGCTAGAATAAAGCAGG - Intergenic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947149671 2:227102354-227102376 CATGGAGGCCAGACCGCAGCTGG - Intronic
947585451 2:231353605-231353627 CAGCCAAGCCAGAGTCCAGCAGG + Intronic
947615499 2:231554542-231554564 CAGTGAGCCCTGTGTGCAGTTGG - Intergenic
947797648 2:232905168-232905190 CAGTGAGCCGAGATGGCAGCAGG - Intronic
947807283 2:232977486-232977508 CAGTGAGGCCTGCCTGCCGCTGG + Intronic
948080429 2:235201009-235201031 CAGTGAGGCCACATTGCTGCAGG - Intergenic
948280528 2:236743981-236744003 CAGTGATGCCAGGTTGCAGCTGG - Intergenic
948371177 2:237489910-237489932 CAGGGAGGAGAGAGTGGAGCTGG - Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948694758 2:239727576-239727598 GAGTGAGGAGAGAGTGCAGCCGG + Intergenic
948851870 2:240712257-240712279 CAGCCAGGAGAGAGTGCAGCTGG + Intergenic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
949015745 2:241709340-241709362 CAGTGACGACAAAGTGCAGCTGG + Exonic
1168903425 20:1385330-1385352 CAGTGAGCCGAGATTGCACCAGG + Intronic
1168970891 20:1930017-1930039 CAGTGAGGGCAGTGTGCAAGGGG - Intronic
1170230071 20:14036719-14036741 CAGTGAGCCAAGATTGCGGCAGG - Intronic
1170230456 20:14041481-14041503 CAATGAGTCCAGATTGCAGTGGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1171360228 20:24582137-24582159 CAGTGGGGAGGGAGTGCAGCAGG - Intronic
1171366626 20:24629264-24629286 CAGTGAGGCGAGTGTGCCTCTGG + Intronic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172823424 20:37759052-37759074 GAGTGAGGCTAGTGTCCAGCAGG + Intronic
1173403834 20:42747932-42747954 CAATGGGGCAAGAGTGGAGCAGG + Intronic
1173456909 20:43210088-43210110 CACTGTGGCCAAAGTACAGCAGG + Intergenic
1173923986 20:46767230-46767252 AAGTGAGGTCAGAGTGCAGCTGG + Intergenic
1175260831 20:57673138-57673160 CAGTGCGGCCAGGGTGCTGGCGG - Intronic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175365718 20:58454373-58454395 CAGTCAGTCCAGAGAGGAGCAGG - Intergenic
1175390706 20:58625642-58625664 CAGTGAGGCCGGGCTGCAGAGGG - Intergenic
1175730718 20:61352130-61352152 TAGTGAGGGCAGAGTGCAGACGG - Intronic
1175942703 20:62545312-62545334 CAGTGAGTCGAGTGTGCACCTGG - Intergenic
1175978431 20:62725264-62725286 CAGGGAGGCCAGAATGATGCTGG - Intronic
1176212508 20:63931903-63931925 CAGTGAGGGGTGACTGCAGCCGG + Exonic
1176370431 21:6058907-6058929 CGGTGAGGCCAGGCTGCAGATGG + Intergenic
1177015001 21:15775758-15775780 CATGGAAGGCAGAGTGCAGCGGG - Intronic
1177998865 21:28135403-28135425 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
1179753088 21:43479634-43479656 CGGTGAGGCCAGGCTGCAGATGG - Intergenic
1180821591 22:18832583-18832605 CAGGGAGGCCACACTGCAGGAGG + Intergenic
1180869389 22:19137807-19137829 CACAGAGGCCAGAGTGCAGAGGG + Intronic
1181191387 22:21143462-21143484 CAGGGAGGCCACACTGCAGGAGG - Intergenic
1181207812 22:21267048-21267070 CAGGGAGGCCACACTGCAGGAGG + Intergenic
1181327030 22:22057753-22057775 CAGTGATGGCAGAATGCAGAAGG - Intergenic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1181333240 22:22111049-22111071 CAGTCTGGCCAGTGAGCAGCAGG + Intergenic
1181474385 22:23159369-23159391 CTGTGATGCCAGTGTGCACCAGG - Intronic
1181621682 22:24095529-24095551 CAGGGAGTCCAGAGTTCAGTGGG + Intronic
1182294084 22:29302955-29302977 CAGTGAGGACAGTGTGATGCAGG + Intergenic
1182500384 22:30742372-30742394 CAGTGAGCCAAGATTGCACCAGG + Intronic
1182718101 22:32376304-32376326 CAGTCTGGCGAGAGAGCAGCAGG + Intronic
1183084047 22:35475571-35475593 CAGTGAGGCCAAAGTGTGGCTGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183569021 22:38638222-38638244 CGGTGGGGCCAGATTGCTGCAGG + Intronic
1183733653 22:39631759-39631781 CACTGAGGGCAGAGTGTAACTGG + Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184033489 22:41908054-41908076 CGGTGAGGCCCAATTGCAGCTGG + Intergenic
1184279674 22:43429842-43429864 CACGGAGGCCACAGTGCAGCTGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184660561 22:45963730-45963752 CTGTGAGCCCAGAGCCCAGCTGG - Intronic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1184957988 22:47905208-47905230 CAGTGAGCCGAGATTGCACCAGG - Intergenic
1185048616 22:48541664-48541686 CAGTGAGGACTCAGTGCACCTGG + Intronic
1185127726 22:49021177-49021199 CAGAGGGGGCAGAGAGCAGCGGG - Intergenic
1203219109 22_KI270731v1_random:28368-28390 CAGGGAGGCCACACTGCAGGAGG - Intergenic
1203271716 22_KI270734v1_random:58459-58481 CAGGGAGGCCACACTGCAGGAGG + Intergenic
949388868 3:3536887-3536909 CAGTGGGGCCAGTGTGCTGTGGG + Intergenic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950534068 3:13569365-13569387 CAGTCTGGCCTGAGAGCAGCTGG - Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
954118274 3:48479099-48479121 CAGGGGGGCCAGTGTGCATCTGG - Intronic
955142921 3:56287512-56287534 CCGTGAGGTCATAGAGCAGCGGG - Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
956343014 3:68247544-68247566 CACTGAGGCCCGGGTGCTGCAGG + Intronic
957476719 3:80734838-80734860 CAGTGCAGCCAGAGGGCTGCTGG - Intergenic
957480990 3:80793307-80793329 CAGTGAGCCAAGATTGCATCTGG + Intergenic
958620144 3:96548334-96548356 AAGTGAGGCCACACTGCACCAGG - Intergenic
960463541 3:117967178-117967200 CAGTGAGGCTAGAACGAAGCTGG + Intergenic
960969366 3:123128545-123128567 CACCCAGGCCAGAGTGCAGAGGG + Intronic
961020101 3:123498122-123498144 CAGTGAGGCCAGCAGGCACCAGG + Intronic
961263180 3:125618920-125618942 CAGTGTGGCTAGAATGAAGCAGG + Intergenic
961265543 3:125639037-125639059 CTCCCAGGCCAGAGTGCAGCGGG - Intergenic
961326203 3:126110877-126110899 AAGTGAGGCCAGTGTTCAGGAGG - Intronic
961512767 3:127413190-127413212 CAGTGAGGCCAGAGCCCAGGAGG - Intergenic
962024502 3:131533077-131533099 CAGAGAGGACAGACTGCAGTTGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964577774 3:158194231-158194253 CAGCCAGGCTGGAGTGCAGCAGG - Intronic
965599039 3:170437286-170437308 CAGGGAGGCCAGTGTGGGGCTGG + Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966594439 3:181712900-181712922 CATTGAGGCCCGGGTGCTGCGGG - Exonic
967171045 3:186824066-186824088 AAGTGAGGTCAGAGTGGAGGAGG - Intergenic
967791508 3:193554312-193554334 CAGTGAAGCAGAAGTGCAGCTGG - Intronic
967939756 3:194756778-194756800 CCTTGAGGCCAGTGTCCAGCAGG - Intergenic
968067036 3:195764440-195764462 CATTGGGGCCACTGTGCAGCAGG + Intronic
968453797 4:687258-687280 GAGGGAGGCCAAAGTGGAGCGGG + Intronic
968678573 4:1899770-1899792 CAGTGAGGCCCACGTGCAGAAGG - Intronic
968704397 4:2071272-2071294 CAGTGAGGCCACTGTGCATGAGG + Intergenic
968809599 4:2793859-2793881 CAGGGAGGCCAGCGTACAGGTGG - Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970764594 4:19532320-19532342 GACTGAGGGCAGATTGCAGCAGG - Intergenic
970853274 4:20626833-20626855 CAGGGAGGTCAGAGAACAGCTGG + Intergenic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
972551935 4:40142017-40142039 CAGTGAGCCGAGATGGCAGCAGG + Intronic
973783771 4:54316093-54316115 GAGTGAGAACAGATTGCAGCAGG - Intergenic
975590280 4:75992859-75992881 CTGGGAGGGCAGGGTGCAGCAGG + Intergenic
975737752 4:77398081-77398103 CAGTGAGGACAGAGTCCTGGTGG + Intronic
976069342 4:81223329-81223351 CAGTGAGGCCAGATTACATGAGG + Intergenic
976739458 4:88343557-88343579 CAGAGATGCCAAAGAGCAGCTGG + Intergenic
977170202 4:93752426-93752448 CAGTGAGCCAAGATTGCACCAGG - Intronic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
978585274 4:110270028-110270050 CAGTGAGCCGAGATTGCACCAGG - Intergenic
979408226 4:120341070-120341092 CAGTGACTCCACAGTGAAGCAGG + Intergenic
979452356 4:120887412-120887434 TAGAGAGGCAAGAGTGGAGCAGG - Intronic
979660193 4:123244255-123244277 CAGTCCCACCAGAGTGCAGCAGG - Intronic
980590705 4:134884535-134884557 GAATGAGGCCAGAGTGCAAGTGG - Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
981143941 4:141303461-141303483 AAGTGTGTCCTGAGTGCAGCTGG + Intergenic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
985075514 4:186210112-186210134 AAATGAGGCCAGAGTGAAACGGG + Intronic
985086863 4:186322862-186322884 CAGTGAGGCCTGCATGCGGCAGG + Intergenic
985291876 4:188394885-188394907 CTGAGAGGCCAGAGTGAGGCCGG + Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
985504021 5:268238-268260 CAGTGAGCCGAGATTGCACCAGG - Intergenic
985529498 5:425373-425395 CAGTGAGCCGAGATTGCACCAGG - Intronic
985664748 5:1176287-1176309 CAGTGATGCCAGAGCCCAGGAGG - Intergenic
985744115 5:1636933-1636955 GAGAGGGGCCAGAGTACAGCAGG + Intergenic
986269329 5:6217577-6217599 CTGTGATGCCAGAATGCAGTGGG - Intergenic
986323191 5:6650368-6650390 CACTCAGGCTAGAGTGCAGTGGG - Intronic
986830350 5:11570224-11570246 CAGCCAGGCCAGATTGGAGCAGG - Intronic
986912033 5:12569758-12569780 CAGTGAAGCCAGAGTTTAGGAGG - Intergenic
987239108 5:15974957-15974979 TTTTGAGGCCAGAATGCAGCAGG + Intergenic
987948799 5:24650272-24650294 CAGTGAGCCCAGATTGCACCAGG + Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989763624 5:45051242-45051264 CAGTGAGCCGAGATTGCACCAGG - Intergenic
990019763 5:51110870-51110892 CAGAAAGGCCAGAATTCAGCAGG - Intergenic
990307389 5:54506630-54506652 CAGTGAGCCAAGATTGCACCTGG - Intergenic
991196107 5:63934419-63934441 CTCTGAGGCCAGAGTGAACCAGG + Intergenic
992070795 5:73146755-73146777 CAGTGAGCCAAGATTGCACCAGG + Intergenic
992669124 5:79041239-79041261 CAGTGAGGTCTGATTGGAGCTGG - Intronic
994153405 5:96475138-96475160 GAGTGAGCCATGAGTGCAGCTGG + Intergenic
995458286 5:112375193-112375215 GAGTGAGCCCAGAGTGGTGCAGG + Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996060098 5:119023619-119023641 AAGTAGGGCCAGGGTGCAGCTGG + Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
996566143 5:124881256-124881278 CACAGAGGCCAGAGTACAGAGGG - Intergenic
996979145 5:129468815-129468837 CGGCCAGGCCAGAGTGCAGTGGG + Intronic
997673598 5:135696009-135696031 CAGAGAGGTCAGTGTGCAGCAGG - Intergenic
997999755 5:138615643-138615665 CAGCCAGGGCAGAGAGCAGCGGG + Intronic
999975180 5:156905204-156905226 CACTCAGGACAGAGTGCAGTGGG + Intergenic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1001748769 5:174111940-174111962 CAGTGAGGAGAGAGAGGAGCGGG - Intronic
1002202308 5:177536698-177536720 CAGTGAGGTCTGAGTGCTGGTGG + Exonic
1002428269 5:179188277-179188299 CAGAGAAGCCACAGAGCAGCAGG - Intronic
1002621857 5:180493974-180493996 CACCCAGGCCAGAGTGCAGTGGG - Intergenic
1002698074 5:181103526-181103548 CATCCAGGCCAGAGTGCAGTGGG + Intergenic
1003097612 6:3154908-3154930 CTGGCAGGCCAGAGTGGAGCCGG - Exonic
1003107152 6:3225796-3225818 CTGGCAGGCCAGAGTGGAGCCGG - Exonic
1003308579 6:4949456-4949478 TAGTTTGGCCAGAGTACAGCAGG - Intronic
1004563333 6:16771940-16771962 CCCTGAGGCAAGAGAGCAGCTGG - Intergenic
1005243054 6:23853969-23853991 CCCTGAGGCTAGAGTCCAGCTGG + Intergenic
1005498679 6:26411480-26411502 TAGTGAGGGGAGAGTGCAGTGGG + Intronic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1006335349 6:33417687-33417709 CAGAGAGGCCTGAGAGCAGGAGG + Exonic
1006519638 6:34563800-34563822 CAGTGGGGCCAGAATGAAGCAGG + Intergenic
1006898163 6:37483861-37483883 AAGTGTGGCCATAGAGCAGCAGG - Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007421857 6:41724471-41724493 CAGTGAGGCCAGAGAGGCCCAGG + Intronic
1007941178 6:45782803-45782825 CAGTCAGGCCACAGTGGATCTGG + Intergenic
1009398789 6:63230557-63230579 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010972029 6:82273280-82273302 CAGTGAGGCCAAGATGAAGCTGG - Intergenic
1011148807 6:84245543-84245565 CAGTGAGCCGAGATGGCAGCAGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013587075 6:111589116-111589138 CAGTGAGCCGAGACTGCACCTGG - Intronic
1013786744 6:113789733-113789755 CAGTGAGGCCAGGGAGCAGTGGG - Intergenic
1015665013 6:135619074-135619096 TTGTGAGGTCTGAGTGCAGCAGG + Intergenic
1017295738 6:152791556-152791578 CAGTGAGGCCAGCGAGCATCTGG - Intergenic
1017426729 6:154329929-154329951 CACGGAGGCCAGAGTGGGGCTGG - Intronic
1017884365 6:158586907-158586929 CAGTGAGGCCTGTGTGCGGGAGG + Intronic
1018081472 6:160262590-160262612 CAGTGAGTTCAGTGTGCAGAAGG + Intronic
1018494121 6:164330539-164330561 CACTCAGGCTAGAGTGCAGTGGG - Intergenic
1018611653 6:165653530-165653552 CAGAAAGGCCAGAGAGCTGCAGG + Intronic
1019003455 6:168776333-168776355 GAGTGAGGCCAGAGGACAACGGG + Intergenic
1019176604 6:170162418-170162440 CAGTGAGGCAGGAGAGCACCTGG + Intergenic
1019463398 7:1173215-1173237 CAGAGAGGGCAGAATGGAGCTGG + Intergenic
1019521094 7:1460816-1460838 CAGTGAGGCCTGTGTGTAGGTGG + Intergenic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019642881 7:2114053-2114075 CTGTAAGGCCTGGGTGCAGCAGG - Intronic
1021800931 7:24305639-24305661 GAGCGAGGGCAGAGTGGAGCTGG + Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022801369 7:33780321-33780343 CAGTGAGGCACCAGGGCAGCTGG - Intergenic
1023195709 7:37636482-37636504 CAGTGGGGACAGAGAGCATCAGG - Intergenic
1023857870 7:44196184-44196206 GAGTGAGGCCAGAGAGGAGCAGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1023976127 7:45031418-45031440 CACTTAGGCTGGAGTGCAGCGGG + Intronic
1024003977 7:45212003-45212025 TAGTGAGGCAAGAGTCTAGCAGG + Intergenic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025178498 7:56813589-56813611 GAGAGAGGCCAGAGTGAGGCAGG + Intergenic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1028635176 7:92980453-92980475 CATGGAGGCCAGAATGCAGTTGG - Intergenic
1029011985 7:97271822-97271844 CAGTGAGCCTAGAAAGCAGCAGG - Intergenic
1029514506 7:101017262-101017284 GGGTGAGGTCAGAGTGGAGCGGG - Intronic
1030563078 7:111115705-111115727 CGCTCAGGCTAGAGTGCAGCTGG + Intronic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034692280 7:153023392-153023414 CAGTGAGGTCGGAATGCAACTGG + Intergenic
1034823875 7:154242663-154242685 CAGTGAGGCCACAGTTCTGCTGG - Intronic
1035231572 7:157468897-157468919 GAGTGAGGCCGGACTGCAGGAGG - Intergenic
1035255314 7:157622211-157622233 CTGTGGTGCCATAGTGCAGCTGG - Intronic
1035720701 8:1789465-1789487 CAGTGAGGCCAGCTTGGGGCAGG - Intergenic
1036755803 8:11470398-11470420 CCTCGAGGCCAGAATGCAGCAGG + Intronic
1038373174 8:27012592-27012614 CCCTGAGGCTAGAGTCCAGCTGG - Intergenic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039827611 8:41188471-41188493 GAGTGAGGGCTGTGTGCAGCTGG + Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1044250701 8:90001531-90001553 GAGCGAGGCCACAGGGCAGCCGG - Exonic
1045027460 8:98101399-98101421 CACAGAGGCCAGAGTACAGCTGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045189817 8:99871577-99871599 CAGTGAGGACACACAGCAGCAGG + Exonic
1047402773 8:124560093-124560115 CACTGAGCTCAGAGTGCAGCTGG - Intronic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1049563405 8:143324823-143324845 CAGGAAGGCCACAGTGCACCAGG + Intronic
1049692024 8:143965654-143965676 CAGTGAGGCCCAAGAGGAGCTGG - Intronic
1049730761 8:144176960-144176982 CAGTGAGGCAAGAGTGAGGCAGG - Intronic
1050648515 9:7748694-7748716 CAGTGAAGACAGAGAACAGCAGG + Intergenic
1051051530 9:12938134-12938156 CAGTGAGCCGAGATTGCATCAGG + Intergenic
1052025356 9:23567948-23567970 CAGTGTGGCCAAAAAGCAGCTGG - Intergenic
1052413167 9:28147743-28147765 CCCTGAGGCTAGAGTCCAGCTGG + Intronic
1053475849 9:38381695-38381717 CCGTGAGGACAGAGTGGAGGTGG - Intergenic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1055770924 9:79716212-79716234 CAAGGAGGCCAGAGTGCATTCGG - Intronic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1056702628 9:88923811-88923833 CAGTGAAGCCACAGTGCCGGAGG - Intergenic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057721106 9:97532458-97532480 CAGTGTTGCCAGGGTGGAGCAGG - Intronic
1057962200 9:99467637-99467659 CAAATAGGCCAGAGTGCAGAGGG + Intergenic
1058506777 9:105674302-105674324 CAGGGAGGCCAGAGTGATGGAGG + Intergenic
1059295277 9:113264819-113264841 CAGTGAGCCAAGATTGCACCTGG + Intronic
1059403856 9:114087896-114087918 CAGTGAGGCCAGGGTCCCCCTGG + Intronic
1060010850 9:120041675-120041697 CAAGGAGGCCAGAGTGTGGCAGG - Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060984611 9:127812917-127812939 CAATGAGGCCAGAGTGGGGAAGG + Intronic
1061436267 9:130564203-130564225 AAGTCATGCCAGAGTGTAGCTGG - Intergenic
1061501851 9:131008674-131008696 CTGTGGGGACAGAGCGCAGCCGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061985846 9:134129768-134129790 CAGCGGGGCTAAAGTGCAGCTGG + Intergenic
1062321550 9:135992783-135992805 CAGAGAGGCCTCAGTGCAGGCGG - Intergenic
1062426960 9:136510535-136510557 CAGGGAGGCCGGAGTGTGGCCGG - Intronic
1062547626 9:137070748-137070770 CTGCGAGGCCAGAGTGGAGCAGG - Intergenic
1186061941 X:5718492-5718514 GAATGAGACCAGAGTGCATCTGG + Intergenic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1186840912 X:13484099-13484121 AAGTCAGGCCAGAGTGCACAAGG - Intergenic
1187418534 X:19114471-19114493 CAGTGATTCCAGTGGGCAGCGGG + Intronic
1187539620 X:20179402-20179424 CAGTCAGGAAAGAGTGCAGAGGG + Intronic
1189453142 X:41158398-41158420 CATTGAGGCCAGAAGGCAGTAGG + Intronic
1189922841 X:45920326-45920348 CACTCAGGCTGGAGTGCAGCTGG + Intergenic
1190961542 X:55254394-55254416 CAGTGAGCCCAGATTGCACCAGG + Intronic
1192554431 X:72078610-72078632 CACGGAGGCCAGACTGCAGCAGG - Intergenic
1194374710 X:93117966-93117988 CATGGATGCCTGAGTGCAGCTGG + Intergenic
1198048155 X:132923003-132923025 CAGTGAGCCAAGATTGCAGTAGG + Intronic
1198432907 X:136585860-136585882 CAGTAAGGCCGGACTGTAGCTGG - Intergenic
1198708158 X:139472112-139472134 CAGTGATGGCTGATTGCAGCTGG - Intergenic
1199482958 X:148318072-148318094 CAGTGAAGCCAGGGTGGAGGGGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1199767677 X:150952908-150952930 CACTGAGGCCTGAGCCCAGCTGG + Intergenic
1200682734 Y:6232032-6232054 CATGGATGCCTGAGTGCAGCTGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201955535 Y:19618415-19618437 CAGTGAAACCAGATGGCAGCTGG + Intergenic