ID: 1005831233

View in Genome Browser
Species Human (GRCh38)
Location 6:29672730-29672752
Sequence GGGCCTTATGGATCACTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005831233_1005831245 10 Left 1005831233 6:29672730-29672752 CCCTCCAGTGATCCATAAGGCCC 0: 1
1: 1
2: 0
3: 8
4: 120
Right 1005831245 6:29672763-29672785 CAAAGGAGAGGTCACAGATAGGG 0: 1
1: 0
2: 2
3: 31
4: 327
1005831233_1005831246 16 Left 1005831233 6:29672730-29672752 CCCTCCAGTGATCCATAAGGCCC 0: 1
1: 1
2: 0
3: 8
4: 120
Right 1005831246 6:29672769-29672791 AGAGGTCACAGATAGGGCAAAGG 0: 1
1: 0
2: 1
3: 40
4: 364
1005831233_1005831240 -2 Left 1005831233 6:29672730-29672752 CCCTCCAGTGATCCATAAGGCCC 0: 1
1: 1
2: 0
3: 8
4: 120
Right 1005831240 6:29672751-29672773 CCTCTTTCTCCCCAAAGGAGAGG 0: 1
1: 0
2: 4
3: 29
4: 271
1005831233_1005831244 9 Left 1005831233 6:29672730-29672752 CCCTCCAGTGATCCATAAGGCCC 0: 1
1: 1
2: 0
3: 8
4: 120
Right 1005831244 6:29672762-29672784 CCAAAGGAGAGGTCACAGATAGG 0: 1
1: 0
2: 2
3: 24
4: 225
1005831233_1005831237 -7 Left 1005831233 6:29672730-29672752 CCCTCCAGTGATCCATAAGGCCC 0: 1
1: 1
2: 0
3: 8
4: 120
Right 1005831237 6:29672746-29672768 AAGGCCCTCTTTCTCCCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005831233 Original CRISPR GGGCCTTATGGATCACTGGA GGG (reversed) Exonic
902755896 1:18548908-18548930 GGGCCTCATGGCTCACAGCAGGG + Intergenic
904245934 1:29188162-29188184 GGGCCTCAAGGATCATGGGAAGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906556774 1:46720097-46720119 GGGCCTTATGGATCACTGAAAGG + Intergenic
907123074 1:52024677-52024699 GGGCCTTATAGGCCACTGCAAGG - Intronic
910662563 1:89689351-89689373 GGGCCTTCTAGGCCACTGGAGGG + Intronic
911340339 1:96628430-96628452 GGGCCTCATTGATCTATGGAGGG - Intergenic
913224603 1:116687759-116687781 GGGCCTTTGAGATCACTGGTGGG + Intergenic
915593935 1:156885821-156885843 GGGCCTTCTGGATCAGCGCAGGG - Intergenic
915651296 1:157312938-157312960 GCTCCTACTGGATCACTGGATGG + Intergenic
916776308 1:167968389-167968411 GGGTGTCATGGCTCACTGGATGG + Intronic
917067446 1:171112213-171112235 GGGCCTTGTAGATCATTGTAAGG + Intronic
917958529 1:180124734-180124756 GGGCCTCATGGGCCACAGGATGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920247224 1:204597404-204597426 GGCCCTGATGGCTCAGTGGAGGG + Intergenic
920249359 1:204613027-204613049 GGGCCCTGTAGACCACTGGAAGG - Intergenic
923334718 1:232958236-232958258 GGGCCTTCTAGGCCACTGGAAGG - Intronic
1075360246 10:121825749-121825771 TGGCCTTATGGAACACAGGGTGG + Intronic
1076735245 10:132456046-132456068 GGTCCTTATGGAGCACAGGTGGG + Intergenic
1081730300 11:45367322-45367344 GGGGCTTATGGAACGCTGGTTGG + Intergenic
1087728996 11:101757511-101757533 AGTCCTTATGGAATACTGGAGGG - Intronic
1087804099 11:102537274-102537296 GGGGCTCATGCATCAGTGGATGG + Intergenic
1087910529 11:103748196-103748218 GTACCTTATGGATCAAAGGAAGG - Intergenic
1090408522 11:126492056-126492078 GGGCCCTTTGGCTCACTGAAGGG - Intronic
1091221111 11:133930653-133930675 GGGCCTTAGGGAGAGCTGGAGGG - Intronic
1096111750 12:49033148-49033170 GGGCCTTATGGGACACAGGCTGG - Exonic
1098197747 12:68019779-68019801 CTGCCTTCTGGATCAGTGGAAGG - Intergenic
1102261334 12:111445218-111445240 AGGCCTTAAGGATCACTGGGAGG - Intronic
1102673544 12:114640260-114640282 GGGCCCCAGGGATCAATGGATGG - Intergenic
1102728255 12:115084898-115084920 GGGCCGTATGGATGGCTGGGGGG + Intergenic
1105676816 13:22680748-22680770 AGGCCTCAGGGATAACTGGAAGG - Intergenic
1115919188 14:38354039-38354061 GAGCCTTGTGGATATCTGGAGGG - Intergenic
1117839762 14:59847762-59847784 GGGCGTTCTCCATCACTGGAAGG - Intronic
1118377205 14:65187805-65187827 GGGCCTCCTGGCTCACTGGGAGG + Intergenic
1123942223 15:25222102-25222124 GGGCCTCATGTATCAATGTAGGG - Intergenic
1124593851 15:31077618-31077640 GGGCCTCGGGGATCCCTGGAAGG + Intronic
1125282846 15:38061344-38061366 GATCCTTATGGATAATTGGAAGG - Intergenic
1128206592 15:65858198-65858220 GGGCCTCATGGGCCACTGTAAGG - Intronic
1128556322 15:68634282-68634304 GGGCCTAATGCATCCCTCGAGGG - Intronic
1129297036 15:74605127-74605149 GGGCCTGGGGGCTCACTGGATGG + Intronic
1129333674 15:74840199-74840221 GGGCCTTAGCGACCACTGGGGGG - Intronic
1129705632 15:77792504-77792526 AGGCCTTATGGAGCTCTGGATGG - Intronic
1134663401 16:16001176-16001198 AGGCCTCATGGATCACTGCAAGG + Intronic
1135520557 16:23173913-23173935 GGGCCTTATGGGCCATTGTAAGG + Intergenic
1136606280 16:31336239-31336261 GGGCCATATGGATCACGGCGTGG - Intergenic
1136989844 16:35145383-35145405 GGACCATAAGGATCCCTGGAGGG + Intergenic
1138156400 16:54708979-54709001 GGGCCTTATGCATCCTTGTAAGG + Intergenic
1139851614 16:69953928-69953950 GGGCTTTTTGCATCACAGGAGGG + Intronic
1139880590 16:70176835-70176857 GGGCTTTTTGCATCACAGGAGGG + Intronic
1140371919 16:74418682-74418704 GGGCTTTTTGCATCACAGGAGGG - Intronic
1148842715 17:50508983-50509005 GGGCCTCAGGGACCACTGGCTGG + Intronic
1151481188 17:74370814-74370836 GGGTGTTCTGGGTCACTGGAGGG + Intronic
1153021263 18:631311-631333 TTGCCTTATGAATCCCTGGAAGG + Intronic
1153181202 18:2435744-2435766 GAGCCTTACGGATCATTGTAAGG - Intergenic
1154234492 18:12591389-12591411 GGGCCTTGCTGACCACTGGAAGG + Intronic
1155378516 18:25189551-25189573 GTGCCTTATAGATCTCAGGATGG - Intronic
1158158234 18:54450062-54450084 GGGCCTTTTAGATGAGTGGAGGG + Intergenic
1161287405 19:3476008-3476030 GAGACTGATGGATCAGTGGATGG + Intronic
1161997069 19:7719750-7719772 GGGCCTTCTGGAACACTGGTGGG + Intergenic
1165322676 19:35095991-35096013 GGGCCTTGTGGGTCACTGTAAGG + Intergenic
1166532900 19:43553184-43553206 GGGACTCCTGGATCACTGGTGGG - Intronic
927087030 2:19682471-19682493 GGGCCTTGTGGATCATAGTAAGG - Intergenic
933417320 2:82002798-82002820 AGGACTTGTGGATCACTGTAAGG - Intergenic
938110936 2:128564467-128564489 GGGCCTTAGCGATCACAGAAAGG - Intergenic
942212881 2:173689207-173689229 TGGCCATATGGGTCACTGGGAGG - Intergenic
942612226 2:177754204-177754226 TGGCCTGATGGTCCACTGGAGGG + Intronic
945586579 2:211672115-211672137 GGGCCTAATGGAAGTCTGGAGGG + Intronic
946757159 2:222959408-222959430 AGGCCTTCTGGATCTGTGGAGGG - Intergenic
947247394 2:228064847-228064869 GAGCCTTGAGCATCACTGGATGG + Intronic
1169279160 20:4252582-4252604 AGCCCTTAAGGATGACTGGAGGG - Intergenic
1169955330 20:11096520-11096542 GGGCCTTATGGGTCAATGAAAGG + Intergenic
1170393538 20:15902026-15902048 TGACCTTGTGGATCGCTGGAAGG - Intronic
1172193802 20:33078294-33078316 GGGCCCCAGGGATCTCTGGATGG + Intergenic
1172829395 20:37820456-37820478 GTGTCTTCTGGAACACTGGAAGG - Intronic
1173297007 20:41768625-41768647 GTGCCTTCTGGATCACAGCAGGG - Intergenic
1173753200 20:45492811-45492833 GGGCCTTGTGGCTCATTGCAAGG + Intergenic
1178485267 21:33015476-33015498 GGGACTTTTGGATGTCTGGAGGG - Intergenic
1179117806 21:38509995-38510017 GGGCCTGGCTGATCACTGGAGGG + Intronic
1179543050 21:42096384-42096406 GGGGTTTTTGGATCACTGGATGG - Intronic
1183019902 22:35018608-35018630 GGGCCTGATGGACCACAGCAAGG - Intergenic
1183735259 22:39641475-39641497 GGGCCCTATGGATCCCAGCAGGG + Intronic
1185011600 22:48317684-48317706 GGGCCTGATGGAGCACTTGGGGG - Intergenic
949157812 3:849320-849342 GGCCCTTATGGTTCCCTGGGAGG + Intergenic
950334362 3:12181905-12181927 GTGCCTTATGGATCCCAAGAAGG + Intronic
950536085 3:13579420-13579442 TGACCTTATGGATCCCTGAAAGG + Intronic
950626831 3:14253440-14253462 GGGCCTTCTGGCTGTCTGGAAGG - Intergenic
950868450 3:16208643-16208665 GGGGCTTATGGGGGACTGGAGGG - Exonic
955274324 3:57533122-57533144 GGCCCATATGGATCACTGCCAGG + Intronic
963962390 3:151323750-151323772 GGGCCTTTTGCATCTCTAGAAGG - Intronic
970938370 4:21601633-21601655 GGACCTTATAGACCAATGGATGG - Intronic
975850259 4:78564917-78564939 GGGCCCTATGGACCAGTGTAAGG + Intronic
982174386 4:152691990-152692012 CTACCTTGTGGATCACTGGATGG - Intronic
983929521 4:173437925-173437947 AGGCCTTATGGATCAACTGAAGG - Intergenic
985076405 4:186219770-186219792 GGGCCTTATGTAGCACTGCCTGG + Intronic
987066236 5:14292610-14292632 GGAACTTATGGGTCTCTGGATGG - Intronic
987503487 5:18743063-18743085 GTGCCAGAGGGATCACTGGAAGG - Intergenic
999438206 5:151580903-151580925 GGGCCTGCTGGATCCTTGGAAGG - Intergenic
1000127542 5:158261229-158261251 GGACCTTATGGACTAATGGAGGG + Intergenic
1001152968 5:169248141-169248163 GGGCCTTAAGGAGCACAGGGAGG - Intronic
1005831233 6:29672730-29672752 GGGCCTTATGGATCACTGGAGGG - Exonic
1007782485 6:44262631-44262653 GGGCCTCATGAATCACTGCCAGG + Exonic
1008016359 6:46524949-46524971 GGTCCTGATGGATCGCTGGGAGG - Intergenic
1013635603 6:112026586-112026608 GGGCATTATGGAGTACAGGATGG + Intergenic
1015469214 6:133584653-133584675 GGGCATTATGGATCTCTGACAGG + Intergenic
1019369703 7:655227-655249 GGGCATTCTGGGTCACTGCAAGG - Intronic
1022388418 7:29923188-29923210 TGGCCTTCTGAATCACTGCATGG - Intronic
1024517183 7:50268835-50268857 AGGCCCTATGGGGCACTGGAAGG - Intergenic
1025965848 7:66270274-66270296 GGACCTTGTAGACCACTGGAAGG + Intronic
1029613600 7:101642174-101642196 GGGTCTCATGGATGACTGGTAGG - Intergenic
1030517523 7:110556970-110556992 GCTCCTGATGGGTCACTGGATGG + Intergenic
1033195503 7:139323914-139323936 GGGGCTAATGGATCACTTGGAGG - Intergenic
1044808285 8:96031152-96031174 GGGTTTTATGGGTCACTGTAAGG - Intergenic
1051165211 9:14254621-14254643 TGGGCTTTTGGATCAGTGGAGGG - Intronic
1058200935 9:102039540-102039562 GGGCCTCATGCAGCCCTGGATGG - Intergenic
1061918288 9:133768640-133768662 GGGCCTCCTGGATCACTGGTTGG - Intronic
1062392728 9:136340409-136340431 GGGCCACATGGAGCCCTGGAAGG - Intronic
1062635295 9:137487397-137487419 GGGGCTCATGGACCCCTGGAGGG + Intronic
1186382101 X:9071610-9071632 GGGCTTTGTGGGTCATTGGAAGG + Intronic
1188412049 X:29884997-29885019 GGGCCTTGTAGATCATTGTAAGG - Intronic
1190144645 X:47879257-47879279 GGGCCTTGTCGACCCCTGGAAGG - Intronic
1192183052 X:68928391-68928413 GGGCCTTGTAGGTCATTGGAAGG - Intergenic
1194287511 X:92028600-92028622 GGGCCTTGTAGACCACTGTAAGG - Intronic
1195793827 X:108621579-108621601 GGGACATATGGTTCACTGGGGGG + Intronic
1195883438 X:109616487-109616509 GGGCCTTATAGATCATGGTAAGG + Intergenic
1196098848 X:111827863-111827885 GGGCCTCATGGACCGTTGGAAGG - Intronic
1196500860 X:116380198-116380220 GGGGCTAATGAATCCCTGGAGGG - Intergenic
1198790734 X:140342725-140342747 CGGCCTTGTAGATCACAGGAAGG + Intergenic
1199778270 X:151034717-151034739 GGACCTTGTGGGTCACGGGAAGG - Intergenic
1200605050 Y:5253167-5253189 GGGCCTTGTAGACCACTGTAAGG - Intronic
1202126518 Y:21573443-21573465 GGCCCTTATGGTACACTGGGAGG + Intergenic