ID: 1005831396

View in Genome Browser
Species Human (GRCh38)
Location 6:29673638-29673660
Sequence TGCCCCCTATCTGCCCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005831396_1005831399 2 Left 1005831396 6:29673638-29673660 CCAGCTGGGGCAGATAGGGGGCA 0: 1
1: 0
2: 1
3: 25
4: 330
Right 1005831399 6:29673663-29673685 GGCCGGCCCCTCTGCATGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005831396 Original CRISPR TGCCCCCTATCTGCCCCAGC TGG (reversed) Exonic