ID: 1005831755

View in Genome Browser
Species Human (GRCh38)
Location 6:29676706-29676728
Sequence GAAGGATGCCAGGATGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005831749_1005831755 8 Left 1005831749 6:29676675-29676697 CCACTCTAACAAATTTCAGGAAG 0: 1
1: 0
2: 0
3: 19
4: 295
Right 1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG 0: 1
1: 0
2: 1
3: 39
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005831755 Original CRISPR GAAGGATGCCAGGATGGTGC GGG Intronic
900230543 1:1554809-1554831 CAGGGAACCCAGGATGGTGCTGG - Intronic
900993366 1:6107923-6107945 GAAGGATGGAAGGAAGGTGGAGG + Intronic
901700005 1:11040172-11040194 GAAGGATGGATGGATGGGGCTGG + Intronic
902799232 1:18819165-18819187 GAAGGAGACCAGGATGTGGCAGG - Intergenic
903018552 1:20377735-20377757 GAAAGATGGCAGGATGGTGTGGG + Intergenic
903062725 1:20681525-20681547 TTAGGATGCCAGGACGGTGGTGG + Intronic
903833797 1:26190024-26190046 CAAGCCTGCCAGGATGGTGGGGG + Intergenic
904334875 1:29790279-29790301 GAGGGATTCCAAGATGATGCTGG - Intergenic
904927455 1:34060056-34060078 GAAGAATGCCAGGAAGGCACAGG + Intronic
905530586 1:38675559-38675581 GAGGGACACCAGGATGGTGCAGG - Intergenic
906032711 1:42733978-42734000 GGAGGAGGCCAGAATGGAGCTGG + Exonic
906726289 1:48046902-48046924 GAATGCTGGCAGGATGGTGAAGG + Intergenic
908114861 1:60930537-60930559 GAAAGAAGCCAGGATGAAGCTGG - Intronic
908712708 1:67034985-67035007 TAGGGATGCAAGGATGGTTCAGG - Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
914702410 1:150147290-150147312 GCAGGATCACAGGATGGAGCAGG + Intergenic
915077017 1:153316743-153316765 CATTGATGTCAGGATGGTGCTGG + Intergenic
915190795 1:154148843-154148865 GAAGTGTTCCAGGATGGTGAAGG + Intronic
915229645 1:154435919-154435941 GGAGGTATCCAGGATGGTGCTGG - Intronic
915463585 1:156083053-156083075 AAAGGGTGCCAGGCTGGGGCTGG + Intronic
915620835 1:157083027-157083049 GAAGGATTCCAAGGTTGTGCTGG - Intergenic
916070245 1:161165840-161165862 GAAGGTTTCGGGGATGGTGCTGG + Intergenic
917163916 1:172090285-172090307 GCAGGAAGCCTGGAGGGTGCTGG + Intronic
918463791 1:184801492-184801514 GAAGGATGAAAGGGTGTTGCAGG - Intronic
919735557 1:200948106-200948128 GAAGGATGCCAGGATTTCCCAGG - Intergenic
919777856 1:201205903-201205925 GAAGGAAGCCAGGGTGTTCCAGG - Intronic
920227976 1:204451561-204451583 GAAGGATTCCTGGAATGTGCTGG + Intronic
921090840 1:211840829-211840851 CAAGGATGACTGGAAGGTGCTGG + Intergenic
922472353 1:225884070-225884092 GAAGGAGGACAGGCAGGTGCGGG - Intergenic
923281624 1:232448690-232448712 GCAGAATGCCAAAATGGTGCAGG + Intronic
923449210 1:234100839-234100861 GTGCGATGCCAGGATGGGGCAGG + Intronic
923613075 1:235512401-235512423 AAAGGAGGCCAGGATGGTTCTGG - Intergenic
923861168 1:237893477-237893499 GATGGATGCCAAGATAATGCAGG + Intergenic
924230491 1:241958279-241958301 GGAGGAGGCCAGGCTGGTGCAGG + Intergenic
924712484 1:246541368-246541390 GAAGGATGGGAGGAGGGTGAAGG + Intronic
1063838637 10:10045474-10045496 GATGGATGCCGGCATGGTGGGGG - Intergenic
1064239224 10:13610204-13610226 GAAGGGTGCCAGGGATGTGCTGG - Intronic
1064770869 10:18721476-18721498 GAAGAATGACAAGATGATGCAGG - Intergenic
1067279619 10:44861329-44861351 GAAGGAAGCCAGGAAGGAGAAGG + Intergenic
1067832434 10:49617833-49617855 GAATGATGCGAGGATGGATCTGG - Intronic
1069619152 10:69825816-69825838 GGAGGATCCCAGGAGGATGCTGG - Intronic
1070433522 10:76364839-76364861 GAAGGATGGGAGGAGGGTGAGGG - Intronic
1075406011 10:122196100-122196122 GAAGGAACCAAGGATGGGGCTGG + Intronic
1075582721 10:123634312-123634334 GAGGGATCACAGGAAGGTGCCGG + Intergenic
1075658277 10:124175817-124175839 GCAGGATGCCAGGCTGGGGGAGG - Intergenic
1076233140 10:128838554-128838576 GAAGTATCCCCGGATGGTGCTGG + Intergenic
1077012747 11:386095-386117 GAGGGAGGCCAAGATGGAGCTGG + Intergenic
1077225354 11:1437024-1437046 GAGGGCTGCCTGGATGGGGCTGG + Intronic
1077541131 11:3147034-3147056 GAAGGATCCCAGGACAGAGCTGG - Intronic
1077897112 11:6461480-6461502 GAATGATGGCAGAGTGGTGCGGG - Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1081852945 11:46286194-46286216 GAAGGAAGGCAGGATGGAGTAGG + Intronic
1083652310 11:64210735-64210757 GAAGGATGACGGGCCGGTGCTGG - Exonic
1083717553 11:64586591-64586613 GAAGGAGGCCAGTATGGTTGGGG - Intergenic
1084181991 11:67451412-67451434 GTAGGATGCGAGGATGGGGTTGG + Exonic
1084422086 11:69065561-69065583 GAAGGAAGGCAGGATGGGCCGGG - Intronic
1084483974 11:69437416-69437438 GCAGGATCCCTGGTTGGTGCAGG - Intergenic
1085599639 11:77843709-77843731 TTAGGATGCCAGCATGGTTCTGG + Intronic
1090037972 11:123265138-123265160 GAAGCCTGCCAGGAGGGTGAAGG + Intergenic
1090276589 11:125424442-125424464 GAAGGCAGCCAGGATGGTGGGGG - Intronic
1090358835 11:126158752-126158774 CAAGGATGTCGGGATGGTGTGGG - Intergenic
1095989611 12:48025609-48025631 GAAGGAGGCCAGGCTTGGGCTGG - Intergenic
1096428000 12:51520649-51520671 TGAGGATGCCAGGAAGCTGCAGG + Intergenic
1097216257 12:57415946-57415968 GAAGGAATCCAGGATTGTGGGGG + Intronic
1097405160 12:59180213-59180235 GAAGGATGAGAGGAAGGTGAAGG + Intergenic
1097672533 12:62557234-62557256 GAAGGATGACAGGATGTTGTTGG + Intronic
1100962824 12:99983450-99983472 GAAGGATGCCAGGTTGGTATTGG - Intronic
1101234321 12:102773293-102773315 GAAGGATGATATGCTGGTGCAGG - Intergenic
1102063382 12:109952354-109952376 GACCCATGCTAGGATGGTGCGGG - Intronic
1102875182 12:116443666-116443688 GAAGGAAGACAGGATGGGGTGGG + Intergenic
1103015942 12:117494577-117494599 CATGGATGCCAGAATGGTCCTGG + Intronic
1103281743 12:119763576-119763598 AAAAGATGCCAGGGTGGTGATGG + Intronic
1103995798 12:124829271-124829293 GATGGGGGCCAGGATGGTGTTGG - Intronic
1107097586 13:36553038-36553060 GAAAGAGGCCAGGATGGTAAGGG + Intergenic
1108404739 13:50089080-50089102 GAAGGAAACCAAGATGGTGAAGG - Intronic
1114015050 14:18420769-18420791 ACAGGATTCCAGGATGCTGCTGG - Intergenic
1114576527 14:23719399-23719421 ACAGGATGCCAGAATGGAGCTGG + Intergenic
1117272422 14:54158564-54158586 CAGGGATGCCAGGATAGGGCAGG - Intergenic
1117537373 14:56714919-56714941 GAAGTGTGCCAGTATGGAGCAGG - Intronic
1117993272 14:61455534-61455556 GCAGGATGCCAATATTGTGCGGG + Intronic
1119413640 14:74455290-74455312 GCAGGACTCCAGGGTGGTGCAGG - Intergenic
1121517754 14:94564088-94564110 GAAGGACGTCTTGATGGTGCTGG + Exonic
1121750908 14:96355369-96355391 AAAGGATTCCCTGATGGTGCTGG - Intronic
1122122471 14:99561786-99561808 GAGGGATGCCAGGTGGGAGCAGG + Intronic
1122487965 14:102094459-102094481 GAAGAGTGCTAGGATGGTGAGGG + Intronic
1130115614 15:81002132-81002154 GGTGGATGGCATGATGGTGCGGG + Exonic
1131400356 15:92120510-92120532 GCAGGCGGCCAGGATGATGCAGG - Exonic
1131631202 15:94178490-94178512 GAAGGATCCCTAGATGGTCCAGG - Intergenic
1132575118 16:660582-660604 GAAGGAGACCCGGATGCTGCTGG - Intronic
1133038518 16:3047333-3047355 CAGGGCTGCCAGGATGGTGGTGG + Intronic
1133421446 16:5650384-5650406 GCAGGATGCCAGGATGATGGAGG - Intergenic
1134057632 16:11180472-11180494 GAAGGAAGGCAGGGTGGAGCGGG + Exonic
1136071853 16:27792100-27792122 GCAGGATGACAGGATGGTGGTGG - Intronic
1137469548 16:48742488-48742510 GAAGGAGGGCAGGGTGGTGACGG - Intergenic
1137476205 16:48811622-48811644 GAAGGAAGGCAGGAAGGGGCGGG - Intergenic
1139396977 16:66648060-66648082 AAAGGATGCGGGGAAGGTGCTGG - Intronic
1140355008 16:74297742-74297764 GAATGATGCCTGGATGATGCCGG + Intronic
1141762686 16:86039017-86039039 GAAGGAGGCCTGGAGGATGCTGG + Intergenic
1142239865 16:88940302-88940324 GAAGGCGGCCAGGCTGGTGGCGG - Exonic
1142805151 17:2367560-2367582 GAAGGAGGCCAGACAGGTGCTGG + Intronic
1143141089 17:4742119-4742141 GAAGGAAGGCAGGGTGGTGGGGG + Intronic
1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG + Intronic
1143260801 17:5596903-5596925 GCAGGATGGCAGGAGGGTGAAGG + Intronic
1143597229 17:7922598-7922620 GAAGGAAGCCAGGCTGGTCCTGG - Exonic
1144630897 17:16871943-16871965 AGAGGATGCCTGGCTGGTGCGGG + Intergenic
1144650417 17:17003532-17003554 AGAGGATGCCTGGCTGGTGCGGG - Intergenic
1145260593 17:21352304-21352326 GCAGGATGGCAGGATGATGGAGG - Intergenic
1145997282 17:29111909-29111931 GAAAGGGGCCAGGGTGGTGCCGG + Intronic
1148478113 17:47942266-47942288 GATGGATGTCAGGACTGTGCTGG + Intronic
1148976124 17:51530440-51530462 GAAGGATGAGAGGAGGGTGAGGG + Intergenic
1150232895 17:63567953-63567975 GAAGGATGCCAGGCTGGGTGCGG - Intronic
1151832908 17:76566121-76566143 GAAGGATGCCGGCCTTGTGCAGG + Exonic
1152132730 17:78486697-78486719 GGAGGATGCCAGGGTCGTGGGGG + Intronic
1153823011 18:8848557-8848579 GATGGATGCGAGGTTGGGGCTGG - Intergenic
1153925072 18:9828200-9828222 GAAAGATGGCGGGATGGTGTGGG + Intronic
1155317049 18:24582270-24582292 GATGGATGCCAGGATTGAGACGG - Intergenic
1155501216 18:26489061-26489083 GAAGGTACCCAGGATGGTCCTGG - Intronic
1155684881 18:28536393-28536415 GAAGGAAGGGAGGATGGTGTGGG + Intergenic
1156357581 18:36355623-36355645 GAAGGCTTCCAGGATGACGCCGG + Exonic
1157871484 18:51233696-51233718 GAAGGATGCCTGGATGGCTGGGG - Intergenic
1160522275 18:79514608-79514630 GAGGCATGCCAGGGTGGTGGGGG - Intronic
1160546108 18:79657093-79657115 GAGGGATGGCAGGATGGAGATGG + Intergenic
1161151292 19:2711428-2711450 GAAGGATGCCAGGGGGTTACGGG - Intergenic
1161322323 19:3646987-3647009 GAAGGATGGGAGGAGGGTGCAGG + Intronic
1161322346 19:3647064-3647086 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322368 19:3647136-3647158 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322377 19:3647170-3647192 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322393 19:3647220-3647242 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322404 19:3647258-3647280 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161566606 19:5006107-5006129 GCAGGGAGCCAGGATGGTGCTGG + Intronic
1162007301 19:7788748-7788770 GAGGGAGGCGAGGATGGGGCGGG - Intergenic
1162716316 19:12636659-12636681 GGAGGGGGCCAGGATGGGGCGGG - Intronic
1162786578 19:13038778-13038800 GATGAAGGCCAGGATGGTGGTGG + Intronic
1164302275 19:23972563-23972585 GAAGGATGCCAGGAGAGAGAGGG + Intergenic
1164783935 19:30914452-30914474 GAAGCCTGCCAGGGTGCTGCTGG + Intergenic
1165404668 19:35622345-35622367 GAAGGAGGCCTGGATGGGGCTGG + Intronic
1165593174 19:36988500-36988522 GAAGGAAGCAGGGAAGGTGCGGG + Intronic
1165717622 19:38056498-38056520 GAAGGATGGGAGCAGGGTGCTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166883004 19:45940352-45940374 GTAGGATGCCAGGAGGTTGGCGG + Exonic
1166918786 19:46214073-46214095 GTAGGAGGCCAGGATGGGGCGGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1168500507 19:56888820-56888842 GAAGTTTGCCAAGTTGGTGCTGG - Intergenic
925904337 2:8530338-8530360 AGAGGGTGCCAGGAGGGTGCAGG + Intergenic
926751267 2:16200402-16200424 GAAGGCTGCGGGGATGGTGGCGG - Intergenic
927075932 2:19577620-19577642 AAAGGATGGCAGGATGATGCAGG + Intergenic
927651038 2:24913969-24913991 GAAGGCAGCCAGGATGGTTGGGG - Intronic
927847095 2:26477255-26477277 GCAGCAGGCCAGGATGCTGCGGG - Exonic
928021082 2:27705623-27705645 GAAGGTTGGGAGGATGGTGAAGG - Intergenic
928647103 2:33366111-33366133 GGAGGAGGCCTGGAAGGTGCTGG + Intronic
928825894 2:35420646-35420668 GAAGTATGCAAGCCTGGTGCTGG + Intergenic
929460101 2:42097095-42097117 GAAGGGTGCCAGGGTGGGGAGGG - Intergenic
931007227 2:57865576-57865598 CAGTGATGCCAGGGTGGTGCTGG + Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933726842 2:85431837-85431859 GCAGGAGGCAAGGATGGGGCGGG - Intronic
935066010 2:99648733-99648755 GAAGGAAGGCAGGGTGGTGAAGG + Intronic
935867472 2:107406035-107406057 ATAGCATGCCAGGATGGTGCCGG - Intergenic
936488319 2:112946553-112946575 GACAGATGCCAAGATGGTTCAGG - Intergenic
936559867 2:113528013-113528035 AAGGGAGCCCAGGATGGTGCAGG + Intergenic
936563307 2:113560862-113560884 GAAGGAGGGCAGGAGGGTGATGG + Intergenic
937040370 2:118816041-118816063 GGAGGCTGCCAGGATGTGGCTGG - Intergenic
937826557 2:126373394-126373416 GAATGATGCCAGAATGATGCCGG - Intergenic
937910296 2:127072332-127072354 GAAGACTGCCTGGAAGGTGCTGG - Intronic
938070507 2:128305843-128305865 CAGGGAGTCCAGGATGGTGCAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940073055 2:149710977-149710999 GCTGGAGGGCAGGATGGTGCTGG + Intergenic
940352105 2:152702213-152702235 GAAGGATGCAAGGATCCTCCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942695330 2:178636110-178636132 GAAGGATGGCAAGATTGTGGTGG - Exonic
943609123 2:190011355-190011377 AAAGAATGACAGAATGGTGCTGG - Intronic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948727311 2:239942920-239942942 GAAGCCTGCAAGGATGGTGGTGG + Intronic
948792828 2:240388163-240388185 GAGGGAGGCCAGGATGGGTCAGG - Intergenic
948903587 2:240967735-240967757 GCAGGAGGCCAGGGTGGGGCAGG - Intronic
1168850898 20:976318-976340 GAAGGAGGCCAGCAGGGTCCAGG + Intronic
1169282760 20:4281022-4281044 CAGGGCTGACAGGATGGTGCAGG - Intergenic
1170488981 20:16851903-16851925 GAAGGATGGCAGGAGGGTAAAGG - Intergenic
1171004769 20:21453689-21453711 GTAGGACGTCAGGATAGTGCAGG + Intergenic
1171428484 20:25063756-25063778 GAAGGACGCCAGGCAGTTGCTGG - Intergenic
1172045874 20:32079827-32079849 GAAGGAGCCCAGCATGTTGCCGG - Exonic
1172479705 20:35263860-35263882 GAAGGGCGCCATGATGGCGCTGG - Exonic
1172556831 20:35849452-35849474 GAGGCAGGGCAGGATGGTGCAGG + Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1174520581 20:51127239-51127261 GAAGGCAGCCAGGATGATGCAGG + Intergenic
1174607692 20:51772839-51772861 GATGGATGACAGGCTGGAGCCGG + Intergenic
1175236841 20:57519785-57519807 GAAGGATGCAGAGATGGGGCGGG - Intronic
1175250573 20:57608084-57608106 GAAGAATGTCAGGATGTTGCAGG + Intronic
1175522095 20:59608570-59608592 GAAGGAGGCCACCATCGTGCTGG - Intronic
1175619776 20:60433580-60433602 AAGAGATGCCAGGATGATGCAGG + Intergenic
1175933386 20:62503862-62503884 CCTGGATGCCAGGATGGGGCTGG + Intergenic
1176457560 21:6927766-6927788 GTAGGGGGCCAGGATGGTGGTGG + Intergenic
1177702191 21:24653748-24653770 GAAGCATGTCTGGATGGTGGAGG + Intergenic
1178794028 21:35726991-35727013 GGAGGAGGGTAGGATGGTGCAGG - Intronic
1178808666 21:35860809-35860831 GAAGGATGTCAGGATCAGGCTGG - Intronic
1178886299 21:36487402-36487424 GGAGGGTGGCAGGATGGTGTTGG - Intronic
1179305654 21:40151833-40151855 GAAGGATGACAGGTTGAGGCAGG + Intronic
1179489637 21:41732668-41732690 GAAGGATGCCAGGTTGGGGATGG - Intergenic
1180439550 22:15351546-15351568 ACAGGATTCCAGGATGCTGCTGG - Intergenic
1181004820 22:20008267-20008289 GGAGGAGGCCAGGCTGGTGCTGG + Intronic
1181029572 22:20143264-20143286 GATGGATGCCATGATGGTCCTGG - Exonic
1181441407 22:22937433-22937455 GAAGGAAGCCAGGATGGACTTGG + Intergenic
1181513682 22:23400054-23400076 GATGGATGCCATGATGGTCCTGG + Intergenic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1183057459 22:35315654-35315676 GACGGATGCCAGGGTGGCCCAGG - Intronic
1183541027 22:38429562-38429584 GAAGGAAGGCAGGAGGGTGATGG - Intronic
1184296593 22:43529032-43529054 GCAGGCTGCCAGGAAGGGGCTGG + Intronic
1184562008 22:45268874-45268896 GAAGAAGGCCAGGATGGAGTTGG + Intergenic
1184870027 22:47231970-47231992 GAAAGATGCCAGGAGGGAGAAGG + Intergenic
949499128 3:4662168-4662190 CAATGATGCCAGCAAGGTGCTGG + Exonic
949674703 3:6440253-6440275 GAGGGATGCCTAGATGGTTCAGG + Intergenic
949831980 3:8224515-8224537 GAAGGATGCCAGGATAATTCTGG + Intergenic
950066575 3:10116368-10116390 GAGGGATGCCAGGATCTTGTAGG + Intronic
950447178 3:13045064-13045086 GCAAGATGGCAGGATGGGGCAGG + Intronic
950586192 3:13894380-13894402 GAAGGATACCGGGAAGGTGGTGG - Intergenic
950620622 3:14202562-14202584 GAAGCAGGCTAGGGTGGTGCTGG + Intergenic
950790679 3:15469305-15469327 GAAGGAAGCCAGGAAGCTTCTGG + Intronic
951185861 3:19712377-19712399 GAAGGAAGCCTGGGTGGTGACGG - Intergenic
952629737 3:35452615-35452637 GAAGCATGCCGGGAGGGTACGGG - Intergenic
953916406 3:46923577-46923599 CGAGGATGCCAGGGTGGTCCAGG + Intronic
953925595 3:46980846-46980868 GCATGATGCCAGGCAGGTGCAGG - Intronic
955676564 3:61454918-61454940 GAGGGATGCCAGGAAGGTTTTGG + Intergenic
956486591 3:69729401-69729423 CAAGGCTGGCAAGATGGTGCAGG + Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960378331 3:116930118-116930140 GATGGCAGGCAGGATGGTGCGGG + Intronic
960759063 3:121052236-121052258 CCTGGATGCCAGGATGATGCGGG - Intronic
960922255 3:122759096-122759118 GCAGGCTGACAGGATGGGGCTGG + Intronic
962626526 3:137231002-137231024 GCAGGATGTCAGGGTGGGGCTGG + Intergenic
966065971 3:175822347-175822369 GCATGGTGCCAGGAAGGTGCTGG - Intergenic
968914668 4:3492234-3492256 CAAGGACGCCAGCATGGTGAGGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969338637 4:6527034-6527056 GAAGGAGCCCAGGCTGGTGTCGG + Intronic
970431263 4:15991009-15991031 GAATGTTGCCAGGATGGTGTCGG - Intronic
970989380 4:22194730-22194752 GAAGGATGACAGGATAATGAAGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
972280265 4:37595544-37595566 GCAGGTAGCCAGGATTGTGCTGG + Intronic
972515995 4:39811135-39811157 CAAGGATGACAGGTGGGTGCTGG + Intergenic
973956687 4:56069733-56069755 GAAGGCTGCCAGAATAGTCCTGG + Intergenic
976748927 4:88434168-88434190 GAAGCATGACAGGATGGGGAAGG + Intronic
978949456 4:114540184-114540206 GGAGGGTGCCAGGAGGGTGAGGG - Intergenic
979553808 4:122021753-122021775 GAAGGATGAAAGGAAGGTGAGGG + Intergenic
982846121 4:160254537-160254559 GAAGGATGCCATGATGGGAGAGG - Intergenic
986509794 5:8491976-8491998 GAAGAATGTCAGGATACTGCTGG - Intergenic
986573488 5:9189226-9189248 GTAAGATGCCAGGAAGGTGACGG - Intronic
986723921 5:10580505-10580527 GAAGGGTGGCAGGGTGGGGCTGG - Intronic
988313081 5:29587280-29587302 TATGGATGCCAGCCTGGTGCAGG - Intergenic
991482045 5:67090903-67090925 GAAGGAGCCCAGGAAGGTGAAGG - Intronic
994732966 5:103516234-103516256 AAAGGATAACAGGATGGAGCAGG + Intergenic
995589019 5:113679135-113679157 GAAGACTGCCAGGGTGGTGGTGG + Intergenic
997466327 5:134090398-134090420 GAAGGGTGCGTGGATGGTGAGGG + Intergenic
997970607 5:138398361-138398383 GAAGGAGGCCATGATGATGGTGG + Exonic
998938616 5:147256902-147256924 GAAGGCTTACAGGAAGGTGCAGG + Intronic
999881855 5:155873520-155873542 GAAGGGTGCCAGGGTGGTGCCGG + Intronic
1000296903 5:159920113-159920135 GAAGGATACCAGGAATCTGCAGG + Intronic
1000649229 5:163795620-163795642 GAAGAAAGTCAGGATGCTGCAGG - Intergenic
1001569366 5:172719981-172720003 TAAGCATGTCAGGATGGTGGAGG - Intergenic
1002185079 5:177450632-177450654 CAATGATGCCAGGATGTTCCGGG - Intronic
1003505782 6:6739212-6739234 GGAGGTTGCCATGAAGGTGCAGG - Intergenic
1005803655 6:29452182-29452204 GAAGAATGGCAGGATGGTGAGGG + Intronic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006406719 6:33849830-33849852 GCAGGAGGCCTGGAAGGTGCCGG - Intergenic
1006650169 6:35544952-35544974 GAAGGAGGGCAGGAGGGTGGAGG + Intergenic
1007755430 6:44096198-44096220 GAAGGATGAGAGCAGGGTGCTGG + Intergenic
1008263596 6:49396704-49396726 GAAGGGTGGGAGGATGGTGAGGG + Intergenic
1010379271 6:75207034-75207056 GTAGGATGCCAGGATGGAGGGGG - Intergenic
1010985028 6:82413713-82413735 GAGGGGTCCCAGGCTGGTGCAGG + Intergenic
1013690990 6:112643460-112643482 GAAGGATGTAAAAATGGTGCTGG - Intergenic
1014844047 6:126254118-126254140 GAAGGATGCTACAATGGAGCTGG - Intergenic
1016118384 6:140316679-140316701 GCAGGATGCGAGGAAAGTGCAGG + Intergenic
1018000812 6:159577023-159577045 GGAGGAAGAGAGGATGGTGCTGG - Intergenic
1018268683 6:162053174-162053196 GAAGGATACCAGGATGGCAGTGG - Intronic
1022288326 7:28976538-28976560 GCAGGATACCAAGATGGTCCAGG - Intergenic
1025762080 7:64404719-64404741 GAAGGATGCCAGGAAAGAGAGGG - Intergenic
1026281877 7:68929352-68929374 GAAAGAGGGCAAGATGGTGCTGG - Intergenic
1028423340 7:90658297-90658319 TCAGGATGCCAGCATGGTTCTGG + Intronic
1029167416 7:98602541-98602563 GCAGAGTGCCTGGATGGTGCAGG - Intergenic
1029944968 7:104522764-104522786 GAAGGCTCACAGCATGGTGCAGG + Intronic
1031960760 7:127987647-127987669 GAAGGATGGAAGGACGGGGCAGG - Intronic
1033330665 7:140414459-140414481 GACAGATGCCAGGATGTTGCAGG + Intronic
1033606045 7:142929154-142929176 GCAGGATGGCAGGATGGGGTGGG + Intronic
1033656366 7:143377521-143377543 GATGGAAGCAAGGATGGGGCAGG + Intergenic
1033718969 7:144036521-144036543 GCAAGATACCAGGATAGTGCAGG - Intergenic
1034285686 7:149881763-149881785 GGAGGATGCCGGGAGGTTGCAGG + Intergenic
1034430757 7:151040187-151040209 GAAGGAAGCCACGGTGGGGCGGG - Intronic
1034553089 7:151833464-151833486 GAAGTCTGCAGGGATGGTGCGGG + Intronic
1035154456 7:156900761-156900783 GAGTGAAGCCAGGATGGTGAGGG - Intergenic
1035648403 8:1246373-1246395 GAAGGATGCCAAGCTGGAGATGG - Intergenic
1036485893 8:9178320-9178342 AAAGGATGTCAGGATGGTCTGGG + Intergenic
1036498512 8:9292742-9292764 GCAGGATGCCAGGATCTTGAAGG + Intergenic
1038765474 8:30423757-30423779 GAAGAAAGGCAGGATGGTGCGGG + Intronic
1040935991 8:52782706-52782728 TAAGGAAGCCAGGCTGCTGCTGG - Intergenic
1041285206 8:56253235-56253257 GAAGCATGCCAGGGTGCTGTGGG + Intergenic
1042502979 8:69529686-69529708 CAAGGCTGGCAGGTTGGTGCTGG + Intronic
1044882726 8:96740960-96740982 GGATGATGTCAGGATGATGCTGG + Intronic
1045047879 8:98296235-98296257 AAAGGATGCCAGGAGGATTCTGG - Intergenic
1045758636 8:105575365-105575387 GAAGGCTCCGAGGATGATGCAGG + Intronic
1047410511 8:124620966-124620988 GAGGGATACCAGGAAGGGGCTGG - Intronic
1047997545 8:130350935-130350957 TAAGCATGCCAGGGTGGAGCTGG + Intronic
1049025866 8:139988443-139988465 CAAAGATGCCCGGATGCTGCTGG + Intronic
1049340513 8:142109848-142109870 GCAGGATACCAGGAGGGTGGGGG + Intergenic
1049486692 8:142868441-142868463 GAAGGGTCCCAGGGTGGCGCAGG + Intronic
1049562495 8:143318692-143318714 GAGGGCTGCCATGCTGGTGCTGG - Intronic
1049615534 8:143574275-143574297 GCCAGATGCCAGGGTGGTGCTGG + Intergenic
1049684970 8:143935675-143935697 GAAGGACACCAGGGTGGGGCTGG + Intronic
1049782697 8:144436057-144436079 GTAGGCTGCCCGGCTGGTGCTGG + Exonic
1049892998 9:88358-88380 AAGGGAGCCCAGGATGGTGCAGG - Intergenic
1051186284 9:14464644-14464666 GAATGATGCCAGGATGGAGGAGG + Intergenic
1051259539 9:15249539-15249561 GAACAATGGCAGGATGATGCTGG - Intronic
1051723982 9:20069545-20069567 AAAGGATGCCTGGATGGTTTTGG - Intergenic
1053009918 9:34627298-34627320 GAAGGTAGGCAGGGTGGTGCTGG + Intronic
1053734219 9:41088416-41088438 AAGGGAGCCCAGGATGGTGCAGG - Intergenic
1054694175 9:68343153-68343175 AAGGGAGCCCAGGATGGTGCAGG + Intronic
1055785222 9:79863772-79863794 GAAGGCGGCCAGGAAGGTGCTGG + Intergenic
1055829137 9:80359453-80359475 GAAGGCGGCCCGGAAGGTGCTGG - Intergenic
1057028779 9:91757422-91757444 GAATGATGCCCCGGTGGTGCAGG - Exonic
1057304147 9:93902786-93902808 GAGGGGTGGCAGGTTGGTGCAGG + Intergenic
1057489712 9:95511328-95511350 GAAGGTGGCCAGGCTGGTGGGGG - Intronic
1058757186 9:108094049-108094071 CCAGGAGGCCAGGAGGGTGCAGG - Intergenic
1059338642 9:113584520-113584542 GGAGGCTGCCAGGATAGTGGGGG - Intronic
1060609149 9:124945693-124945715 GAAGGGTGTCAGGATGATGTAGG - Intronic
1060876062 9:127084433-127084455 GAGGGCTGCCTGGATGGTGGGGG - Intronic
1060938286 9:127528467-127528489 CCAGGAAGCCAGGAAGGTGCAGG - Intronic
1061133351 9:128720419-128720441 GAAGGGGGGCTGGATGGTGCGGG - Exonic
1061399643 9:130361436-130361458 GAAGAGGGCCAGGATGGTGCTGG + Intronic
1061981024 9:134103717-134103739 GAAGGATGGATGGATGGTGGTGG - Intergenic
1186879895 X:13854321-13854343 AAAGGATCTGAGGATGGTGCTGG + Intronic
1188316320 X:28678178-28678200 GAAGTATGCTAGAGTGGTGCAGG + Intronic
1189155337 X:38750901-38750923 GAAGGCTGCCAGGTGGGTGCTGG + Intergenic
1190735715 X:53254857-53254879 GAAGGCTGTCTGGATGGTCCTGG + Exonic
1193199807 X:78675381-78675403 GAAGAGTGCCAGGATGATGAGGG - Intergenic
1194081492 X:89471733-89471755 GAAGGTTGCCAGAATAGTCCAGG - Intergenic
1195840606 X:109172263-109172285 GAGGGGTCCCAGGGTGGTGCTGG - Intergenic
1197796037 X:130299558-130299580 GAGGGAGGCCAAGATGGGGCTGG - Intergenic
1200179059 X:154139342-154139364 AAAGGAAGACAGGAGGGTGCGGG - Intergenic
1200434163 Y:3127919-3127941 GAAGGTTGCCAGAATAGTCCAGG - Intergenic
1201560792 Y:15314337-15314359 GAAGGGTGGCAGGATGGTGAGGG - Intergenic