ID: 1005834124

View in Genome Browser
Species Human (GRCh38)
Location 6:29695095-29695117
Sequence GCTGCCTGTGCTCACCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005834124_1005834127 -1 Left 1005834124 6:29695095-29695117 CCACAATGGTGAGCACAGGCAGC No data
Right 1005834127 6:29695117-29695139 CAGCTTTCAGGCAGGAGTGATGG No data
1005834124_1005834129 5 Left 1005834124 6:29695095-29695117 CCACAATGGTGAGCACAGGCAGC No data
Right 1005834129 6:29695123-29695145 TCAGGCAGGAGTGATGGCATGGG No data
1005834124_1005834130 15 Left 1005834124 6:29695095-29695117 CCACAATGGTGAGCACAGGCAGC No data
Right 1005834130 6:29695133-29695155 GTGATGGCATGGGAAACTTCTGG No data
1005834124_1005834126 -9 Left 1005834124 6:29695095-29695117 CCACAATGGTGAGCACAGGCAGC No data
Right 1005834126 6:29695109-29695131 ACAGGCAGCAGCTTTCAGGCAGG No data
1005834124_1005834131 30 Left 1005834124 6:29695095-29695117 CCACAATGGTGAGCACAGGCAGC No data
Right 1005834131 6:29695148-29695170 ACTTCTGGTGAAACGTGCCTAGG No data
1005834124_1005834128 4 Left 1005834124 6:29695095-29695117 CCACAATGGTGAGCACAGGCAGC No data
Right 1005834128 6:29695122-29695144 TTCAGGCAGGAGTGATGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005834124 Original CRISPR GCTGCCTGTGCTCACCATTG TGG (reversed) Intergenic
No off target data available for this crispr