ID: 1005841074

View in Genome Browser
Species Human (GRCh38)
Location 6:29744907-29744929
Sequence CAGGTTCAGGCTTCTATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005841062_1005841074 4 Left 1005841062 6:29744880-29744902 CCTTCCTTTCCTGCCTAATGCCC No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data
1005841059_1005841074 18 Left 1005841059 6:29744866-29744888 CCCTGGCCTTGAGGCCTTCCTTT No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data
1005841060_1005841074 17 Left 1005841060 6:29744867-29744889 CCTGGCCTTGAGGCCTTCCTTTC No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data
1005841063_1005841074 0 Left 1005841063 6:29744884-29744906 CCTTTCCTGCCTAATGCCCACCC No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data
1005841065_1005841074 -5 Left 1005841065 6:29744889-29744911 CCTGCCTAATGCCCACCCCAGGT No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data
1005841066_1005841074 -9 Left 1005841066 6:29744893-29744915 CCTAATGCCCACCCCAGGTTCAG No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data
1005841061_1005841074 12 Left 1005841061 6:29744872-29744894 CCTTGAGGCCTTCCTTTCCTGCC No data
Right 1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005841074 Original CRISPR CAGGTTCAGGCTTCTATAGG AGG Intergenic
No off target data available for this crispr