ID: 1005845202

View in Genome Browser
Species Human (GRCh38)
Location 6:29771656-29771678
Sequence TAGTGGGGCACTATTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005845198_1005845202 -10 Left 1005845198 6:29771643-29771665 CCACCATGTGCCCTAGTGGGGCA No data
Right 1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG No data
1005845197_1005845202 -9 Left 1005845197 6:29771642-29771664 CCCACCATGTGCCCTAGTGGGGC No data
Right 1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG No data
1005845190_1005845202 26 Left 1005845190 6:29771607-29771629 CCACCTCTGAATGTCCAACTCAT No data
Right 1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG No data
1005845191_1005845202 23 Left 1005845191 6:29771610-29771632 CCTCTGAATGTCCAACTCATCAG No data
Right 1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG No data
1005845193_1005845202 12 Left 1005845193 6:29771621-29771643 CCAACTCATCAGCATTTGAGGCC No data
Right 1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005845202 Original CRISPR TAGTGGGGCACTATTTCTTT AGG Intergenic
No off target data available for this crispr