ID: 1005845392

View in Genome Browser
Species Human (GRCh38)
Location 6:29772876-29772898
Sequence GAGGCAGGTTACCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005845392_1005845397 -2 Left 1005845392 6:29772876-29772898 CCTTTCCCAGGGTAACCTGCCTC No data
Right 1005845397 6:29772897-29772919 TCCGTTGCTATATCTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005845392 Original CRISPR GAGGCAGGTTACCCTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr