ID: 1005845393

View in Genome Browser
Species Human (GRCh38)
Location 6:29772881-29772903
Sequence CAACGGAGGCAGGTTACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005845393_1005845397 -7 Left 1005845393 6:29772881-29772903 CCCAGGGTAACCTGCCTCCGTTG No data
Right 1005845397 6:29772897-29772919 TCCGTTGCTATATCTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005845393 Original CRISPR CAACGGAGGCAGGTTACCCT GGG (reversed) Intergenic
No off target data available for this crispr