ID: 1005845394

View in Genome Browser
Species Human (GRCh38)
Location 6:29772882-29772904
Sequence GCAACGGAGGCAGGTTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005845394_1005845397 -8 Left 1005845394 6:29772882-29772904 CCAGGGTAACCTGCCTCCGTTGC No data
Right 1005845397 6:29772897-29772919 TCCGTTGCTATATCTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005845394 Original CRISPR GCAACGGAGGCAGGTTACCC TGG (reversed) Intergenic
No off target data available for this crispr