ID: 1005845397

View in Genome Browser
Species Human (GRCh38)
Location 6:29772897-29772919
Sequence TCCGTTGCTATATCTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005845393_1005845397 -7 Left 1005845393 6:29772881-29772903 CCCAGGGTAACCTGCCTCCGTTG No data
Right 1005845397 6:29772897-29772919 TCCGTTGCTATATCTCTGACAGG No data
1005845394_1005845397 -8 Left 1005845394 6:29772882-29772904 CCAGGGTAACCTGCCTCCGTTGC No data
Right 1005845397 6:29772897-29772919 TCCGTTGCTATATCTCTGACAGG No data
1005845392_1005845397 -2 Left 1005845392 6:29772876-29772898 CCTTTCCCAGGGTAACCTGCCTC No data
Right 1005845397 6:29772897-29772919 TCCGTTGCTATATCTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005845397 Original CRISPR TCCGTTGCTATATCTCTGAC AGG Intergenic
No off target data available for this crispr