ID: 1005846277

View in Genome Browser
Species Human (GRCh38)
Location 6:29781549-29781571
Sequence CTCTCGGCAGAAACTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005846275_1005846277 -3 Left 1005846275 6:29781529-29781551 CCATCAGACTAACAGCTGATCTC 0: 1342
1: 4586
2: 3146
3: 1798
4: 1323
Right 1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG No data
1005846273_1005846277 11 Left 1005846273 6:29781515-29781537 CCACAAAGGGAAACCCATCAGAC 0: 162
1: 6002
2: 2817
3: 820
4: 423
Right 1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG No data
1005846272_1005846277 12 Left 1005846272 6:29781514-29781536 CCCACAAAGGGAAACCCATCAGA 0: 169
1: 4876
2: 4607
3: 2412
4: 1438
Right 1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG No data
1005846274_1005846277 -2 Left 1005846274 6:29781528-29781550 CCCATCAGACTAACAGCTGATCT 0: 1312
1: 4659
2: 3111
3: 2328
4: 1903
Right 1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005846277 Original CRISPR CTCTCGGCAGAAACTCTACA AGG Intergenic
No off target data available for this crispr