ID: 1005849998

View in Genome Browser
Species Human (GRCh38)
Location 6:29814033-29814055
Sequence ATGAGTCACCACCACCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005849991_1005849998 27 Left 1005849991 6:29813983-29814005 CCATCTGCCCAGGCCTGAGTGGC No data
Right 1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG No data
1005849993_1005849998 19 Left 1005849993 6:29813991-29814013 CCAGGCCTGAGTGGCCAACTAAC No data
Right 1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG No data
1005849994_1005849998 14 Left 1005849994 6:29813996-29814018 CCTGAGTGGCCAACTAACTGTGC No data
Right 1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG No data
1005849989_1005849998 28 Left 1005849989 6:29813982-29814004 CCCATCTGCCCAGGCCTGAGTGG No data
Right 1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG No data
1005849996_1005849998 5 Left 1005849996 6:29814005-29814027 CCAACTAACTGTGCAATTAGGTT No data
Right 1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG No data
1005849992_1005849998 20 Left 1005849992 6:29813990-29814012 CCCAGGCCTGAGTGGCCAACTAA No data
Right 1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005849998 Original CRISPR ATGAGTCACCACCACCTCAC TGG Intergenic
No off target data available for this crispr