ID: 1005850521

View in Genome Browser
Species Human (GRCh38)
Location 6:29817352-29817374
Sequence TAGTGGGGCGCTATTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005850512_1005850521 20 Left 1005850512 6:29817309-29817331 CCTGAATGTCAACTCGTCAGCAT No data
Right 1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG No data
1005850518_1005850521 -10 Left 1005850518 6:29817339-29817361 CCATGATGTGCCCTAGTGGGGCG No data
Right 1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG No data
1005850511_1005850521 25 Left 1005850511 6:29817304-29817326 CCACTCCTGAATGTCAACTCGTC No data
Right 1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG No data
1005850517_1005850521 -9 Left 1005850517 6:29817338-29817360 CCCATGATGTGCCCTAGTGGGGC No data
Right 1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005850521 Original CRISPR TAGTGGGGCGCTATTTCTTT AGG Intergenic
No off target data available for this crispr