ID: 1005851707

View in Genome Browser
Species Human (GRCh38)
Location 6:29827909-29827931
Sequence GACCCCGCACTCACCCGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 4, 1: 4, 2: 1, 3: 15, 4: 162}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005851707_1005851715 11 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851715 6:29827943-29827965 AGCCCCTGCGCGGAGGAGGGAGG 0: 1
1: 0
2: 3
3: 33
4: 269
1005851707_1005851718 13 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851718 6:29827945-29827967 CCCCTGCGCGGAGGAGGGAGGGG 0: 1
1: 1
2: 3
3: 38
4: 377
1005851707_1005851723 25 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851723 6:29827957-29827979 GGAGGGAGGGGCCGGCCCGGCGG 0: 1
1: 2
2: 7
3: 130
4: 1108
1005851707_1005851711 1 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851711 6:29827933-29827955 GGAGGGAAACAGCCCCTGCGCGG 0: 1
1: 0
2: 1
3: 18
4: 231
1005851707_1005851725 27 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851725 6:29827959-29827981 AGGGAGGGGCCGGCCCGGCGGGG 0: 1
1: 1
2: 8
3: 84
4: 838
1005851707_1005851726 28 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851726 6:29827960-29827982 GGGAGGGGCCGGCCCGGCGGGGG 0: 1
1: 2
2: 8
3: 157
4: 1203
1005851707_1005851712 4 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851712 6:29827936-29827958 GGGAAACAGCCCCTGCGCGGAGG 0: 1
1: 0
2: 2
3: 14
4: 195
1005851707_1005851724 26 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851724 6:29827958-29827980 GAGGGAGGGGCCGGCCCGGCGGG 0: 1
1: 0
2: 9
3: 72
4: 915
1005851707_1005851714 8 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851714 6:29827940-29827962 AACAGCCCCTGCGCGGAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 111
1005851707_1005851721 17 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851721 6:29827949-29827971 TGCGCGGAGGAGGGAGGGGCCGG 0: 1
1: 0
2: 7
3: 69
4: 903
1005851707_1005851716 12 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851716 6:29827944-29827966 GCCCCTGCGCGGAGGAGGGAGGG 0: 1
1: 1
2: 6
3: 25
4: 323
1005851707_1005851722 22 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851722 6:29827954-29827976 GGAGGAGGGAGGGGCCGGCCCGG 0: 1
1: 2
2: 20
3: 177
4: 1466
1005851707_1005851713 7 Left 1005851707 6:29827909-29827931 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005851713 6:29827939-29827961 AAACAGCCCCTGCGCGGAGGAGG 0: 1
1: 0
2: 4
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005851707 Original CRISPR GACCCCGCACTCACCCGCCC AGG (reversed) Exonic