ID: 1005852508

View in Genome Browser
Species Human (GRCh38)
Location 6:29832149-29832171
Sequence GATATTGCCTTTAGAATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005852502_1005852508 24 Left 1005852502 6:29832102-29832124 CCACAGCGGCTACAAAATGACAT No data
Right 1005852508 6:29832149-29832171 GATATTGCCTTTAGAATAGGGGG No data
1005852504_1005852508 -3 Left 1005852504 6:29832129-29832151 CCTGAGTCTACATTAATAAAGAT No data
Right 1005852508 6:29832149-29832171 GATATTGCCTTTAGAATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005852508 Original CRISPR GATATTGCCTTTAGAATAGG GGG Intergenic
No off target data available for this crispr