ID: 1005854253

View in Genome Browser
Species Human (GRCh38)
Location 6:29848577-29848599
Sequence TCTGCAGCTGTGCCCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005854253_1005854256 0 Left 1005854253 6:29848577-29848599 CCAAGTGTGGGCACAGCTGCAGA No data
Right 1005854256 6:29848600-29848622 CATGCCTTGTCTCTTGGGTCAGG No data
1005854253_1005854254 -6 Left 1005854253 6:29848577-29848599 CCAAGTGTGGGCACAGCTGCAGA No data
Right 1005854254 6:29848594-29848616 TGCAGACATGCCTTGTCTCTTGG No data
1005854253_1005854259 8 Left 1005854253 6:29848577-29848599 CCAAGTGTGGGCACAGCTGCAGA No data
Right 1005854259 6:29848608-29848630 GTCTCTTGGGTCAGGACACAGGG No data
1005854253_1005854255 -5 Left 1005854253 6:29848577-29848599 CCAAGTGTGGGCACAGCTGCAGA No data
Right 1005854255 6:29848595-29848617 GCAGACATGCCTTGTCTCTTGGG No data
1005854253_1005854260 21 Left 1005854253 6:29848577-29848599 CCAAGTGTGGGCACAGCTGCAGA No data
Right 1005854260 6:29848621-29848643 GGACACAGGGTAGAGTGAAATGG No data
1005854253_1005854258 7 Left 1005854253 6:29848577-29848599 CCAAGTGTGGGCACAGCTGCAGA No data
Right 1005854258 6:29848607-29848629 TGTCTCTTGGGTCAGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005854253 Original CRISPR TCTGCAGCTGTGCCCACACT TGG (reversed) Intergenic
No off target data available for this crispr