ID: 1005857371

View in Genome Browser
Species Human (GRCh38)
Location 6:29872759-29872781
Sequence CAGTGGGGCACTATTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 2, 2: 3, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005857362_1005857371 12 Left 1005857362 6:29872724-29872746 CCAACTCATCAGCAATTGAGGCC No data
Right 1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG 0: 1
1: 2
2: 3
3: 8
4: 94
1005857367_1005857371 -10 Left 1005857367 6:29872746-29872768 CCATGATGTGCCCCAGTGGGGCA 0: 1
1: 1
2: 3
3: 19
4: 172
Right 1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG 0: 1
1: 2
2: 3
3: 8
4: 94
1005857366_1005857371 -9 Left 1005857366 6:29872745-29872767 CCCATGATGTGCCCCAGTGGGGC 0: 1
1: 3
2: 1
3: 14
4: 134
Right 1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG 0: 1
1: 2
2: 3
3: 8
4: 94
1005857360_1005857371 23 Left 1005857360 6:29872713-29872735 CCTCTGAATGTCCAACTCATCAG No data
Right 1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG 0: 1
1: 2
2: 3
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005857371 Original CRISPR CAGTGGGGCACTATTTCTTT AGG Intergenic
905341831 1:37283471-37283493 CACAGGGGAACTATCTCTTTGGG + Intergenic
914258315 1:145978178-145978200 CTGGGGGGCACTATCTCTGTTGG - Intronic
916295605 1:163216044-163216066 CAGTGGAGCACTGATTCTGTAGG + Intronic
919837651 1:201586732-201586754 CAGTGGGGCCCTAATTCAATAGG - Intergenic
922620865 1:226987311-226987333 CTGTGGGGCAGCAGTTCTTTAGG - Exonic
1064713795 10:18154426-18154448 GAGTGGGGCTCTAATTCATTAGG + Intronic
1067931807 10:50569511-50569533 CAGTGGAGCACCATTTCCATGGG - Intronic
1074347165 10:112698408-112698430 CAGAAGAGCACTATGTCTTTTGG + Intronic
1074408204 10:113199432-113199454 CAGTGTGGCTAGATTTCTTTGGG + Intergenic
1074956271 10:118393139-118393161 CGGTGGGGAAGTATTTCTATAGG - Intergenic
1078127132 11:8577968-8577990 CAGTGAGTCATTTTTTCTTTAGG + Intronic
1080061632 11:27962428-27962450 CAGTGGGCCAGTCTTTCTTCAGG + Intergenic
1081874607 11:46400067-46400089 CAGTGGAGCTCTATTGCTGTGGG + Intronic
1083007092 11:59356708-59356730 CAGGAGGGCAATATTTGTTTGGG + Intergenic
1087090371 11:94264861-94264883 AAGTGGGACCCTATCTCTTTAGG - Intergenic
1087588944 11:100159854-100159876 CCATGGGCCACTATTTCTTCAGG + Intronic
1091547865 12:1516085-1516107 CAGTTGGGCATTATTTGTGTAGG + Intergenic
1092831756 12:12451025-12451047 TACTGGAGGACTATTTCTTTTGG - Intronic
1092851283 12:12629515-12629537 CAGGGGGGCAAGAATTCTTTTGG + Intronic
1097325337 12:58270211-58270233 CAGTGGACAATTATTTCTTTGGG - Intergenic
1099384354 12:81997092-81997114 CAGTGTGGCACTATTCCTCAAGG + Intergenic
1102983767 12:117262754-117262776 CAGTGGGGTTCTCTTTTTTTTGG + Intronic
1104287607 12:127439333-127439355 CAGTGGAGGACTGTTTCTTATGG - Intergenic
1106869425 13:34002805-34002827 CATTGGGGTCTTATTTCTTTAGG - Intergenic
1108047452 13:46396640-46396662 CAGTGGGGCTCTGTTCCTTTTGG - Intronic
1110307285 13:74003905-74003927 CAGTGGGGCAGTTTTTGTTTTGG - Intronic
1111017338 13:82398625-82398647 CAGTGAGACACTTTTTCTGTTGG - Intergenic
1111033336 13:82636497-82636519 CACTGGGGGACAATTTGTTTTGG - Intergenic
1114587902 14:23831687-23831709 CAGTGCTGCACTATCTCTTGTGG - Intergenic
1115925282 14:38426025-38426047 GAGTGGGGAACTATTTCTAGAGG + Intergenic
1118392432 14:65306671-65306693 CACTGGGGATCAATTTCTTTGGG - Intergenic
1119127513 14:72141428-72141450 CACTGGGGCACTATTACACTCGG - Intronic
1125070348 15:35546452-35546474 CAGTGGCGCAGGATTTGTTTTGG + Intergenic
1125289213 15:38127267-38127289 CAGTCAGGCACTATGTCCTTGGG + Intergenic
1126247671 15:46528058-46528080 CAGTATGGCACAATTTCTTCAGG - Intergenic
1128870347 15:71150468-71150490 CAGAGGGGCAATTATTCTTTGGG - Intronic
1129601448 15:77001209-77001231 CACTTGGGGATTATTTCTTTGGG + Intronic
1144299242 17:13907787-13907809 CAATGGGCCACTCTTTCTTCGGG + Intergenic
1144581383 17:16461344-16461366 CAGTGGGGAAGCACTTCTTTTGG + Intronic
1147039859 17:37710215-37710237 CGGTGGGACACTGTTTGTTTTGG - Intronic
1153022113 18:638907-638929 CAGTGGGGCTTTATCTGTTTTGG - Intronic
1158250978 18:55487026-55487048 CAGTGGCTCCCTATTGCTTTGGG + Intronic
925316708 2:2932245-2932267 CATTCGGTCACTCTTTCTTTTGG - Intergenic
930277670 2:49332367-49332389 GAGTGGGTAACTATTTGTTTTGG - Intergenic
934522778 2:95030406-95030428 CAGTGAGGAACTTTTCCTTTTGG + Intronic
937389517 2:121471933-121471955 CAGTGGGTGACTTTTCCTTTGGG - Intronic
939006575 2:136795209-136795231 CAGCAGGGCTGTATTTCTTTTGG + Intronic
940213279 2:151277899-151277921 CACTGGGCCAATATTTCTCTCGG - Intronic
942066408 2:172275748-172275770 CATTGGAGCATTCTTTCTTTTGG + Intergenic
942323209 2:174753862-174753884 CTGTGGGACACTACTGCTTTGGG + Intronic
942701488 2:178716153-178716175 CAGTGGAGAACTATTTCCTAAGG + Intronic
946552408 2:220817047-220817069 CAGAGGAGCAGTTTTTCTTTAGG + Intergenic
947945405 2:234097608-234097630 CAGTGAGGCAGCATTTGTTTGGG + Intergenic
1170667993 20:18403351-18403373 CAATGTGGCACCATTGCTTTAGG - Intronic
1170690514 20:18611238-18611260 CAGTGTGTCACATTTTCTTTTGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1180849178 22:19004371-19004393 CAGTGAGACCCTATCTCTTTGGG + Intergenic
1185197390 22:49480646-49480668 CAAGGGGACACTGTTTCTTTGGG - Intronic
952448438 3:33406926-33406948 CAGTGTGGCACCATTTCATTCGG + Intronic
952604214 3:35124740-35124762 CAGTGGGGCACTGCTGATTTGGG + Intergenic
952914681 3:38225783-38225805 CAGTGGGTCACTATTCATTCTGG + Intronic
956006949 3:64790220-64790242 TAGTCGGGAAATATTTCTTTAGG + Intergenic
962963816 3:140335455-140335477 CAGTGGGGCTTTTTTTTTTTTGG - Intronic
967400732 3:189057281-189057303 CATTGGTACACTATTTCTTCAGG + Intronic
967736357 3:192956886-192956908 CCGTGGAGGACTGTTTCTTTGGG + Intergenic
972035839 4:34519509-34519531 GACTGGGGCATTATTTCTCTAGG - Intergenic
974274022 4:59691773-59691795 CAGTGGGCAAATATTTCTTTTGG + Intergenic
978223832 4:106309928-106309950 CTTTGGGGCACCATTTATTTTGG - Intronic
978705250 4:111701204-111701226 CAGTGGGGCACTATTCATAGAGG + Intergenic
988400068 5:30750982-30751004 CAGTGTGGCATTATTCCTTGAGG - Intergenic
990934511 5:61133245-61133267 CATTATAGCACTATTTCTTTGGG + Intronic
996660243 5:125993970-125993992 CAGTGGGTCACCCTTTCTGTAGG - Intergenic
996816906 5:127584162-127584184 CAGTTGGGCTGTGTTTCTTTTGG - Intergenic
997886876 5:137638135-137638157 TAGTGGTGCATTGTTTCTTTTGG - Intronic
998169369 5:139863613-139863635 CAGTGGGGCAATATTCCTCTCGG - Intronic
998314305 5:141167148-141167170 CAGTGGAACAATAATTCTTTTGG + Intergenic
999843329 5:155452168-155452190 CTGTAGGGCCCTATTTCTGTTGG + Intergenic
1001123986 5:169002998-169003020 CAGTGGGGCACTTATTCTTTGGG + Intronic
1005352083 6:24946694-24946716 CCTTGGGCCCCTATTTCTTTTGG - Intronic
1005836533 6:29713692-29713714 CAGTGGGGCTATATTTCTTTAGG + Intergenic
1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG + Intergenic
1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG + Intergenic
1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG + Intergenic
1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG + Intergenic
1006038241 6:31230985-31231007 CAGTGTGGCATCATCTCTTTGGG + Intergenic
1006066285 6:31464650-31464672 TGGTAGGGCTCTATTTCTTTAGG - Intergenic
1008895939 6:56555234-56555256 CAGTGGGGCAGAGTCTCTTTGGG + Intronic
1012034037 6:94108810-94108832 CAATAAGGCACTATTTCTCTAGG - Intergenic
1012584436 6:100905062-100905084 CAGTGCAGCACTACTTCTTTGGG + Intergenic
1014117259 6:117679535-117679557 CAGTTGGGCAGTTTTTCCTTTGG + Intronic
1015083979 6:129265137-129265159 AAGTGGAGTAATATTTCTTTAGG + Intronic
1015598682 6:134891555-134891577 CATTGGGGCACTTTTACTCTGGG - Intergenic
1030862859 7:114658284-114658306 CAGTAGAGCACTTTTACTTTGGG + Intronic
1036169987 8:6474463-6474485 CAGTGGTGCAATTTTTTTTTTGG - Intronic
1037154000 8:15677178-15677200 CAGTGAGACCCTATTTCTTGGGG - Intronic
1038898498 8:31814864-31814886 CAGGGGGGCACCATTTGTATGGG - Intronic
1039935325 8:42038921-42038943 TAGTGTGGCACTATTTTATTAGG - Intronic
1042940459 8:74101899-74101921 AAGTGAGTCACAATTTCTTTTGG - Intergenic
1044028469 8:87204099-87204121 GAGTGTGGCACAATTTCTTTTGG + Intronic
1044109135 8:88249853-88249875 CAGTTGGGCCCTCTTGCTTTGGG - Intronic
1047554082 8:125909910-125909932 CAGTGGGGCACAAATTATTTTGG - Intergenic
1188688249 X:33096805-33096827 CAAAGGGACAATATTTCTTTAGG + Intronic
1194219533 X:91174651-91174673 CAGAGAGACTCTATTTCTTTAGG - Intergenic
1195658362 X:107354833-107354855 CACTAGGGAACTATTTGTTTAGG + Intergenic
1197009830 X:121546798-121546820 CTGAAGGGCACTATTTCTGTGGG - Intergenic
1198767418 X:140093302-140093324 CAGTGGTGCTCTTTTTTTTTAGG + Intergenic
1199616932 X:149663607-149663629 CAGTAGGGCACCATTACTTAAGG - Intergenic
1199625709 X:149739641-149739663 CAGTAGGGCACCATTACTTAAGG + Intergenic