ID: 1005863126

View in Genome Browser
Species Human (GRCh38)
Location 6:29916598-29916620
Sequence TAGTGGGGCACTATTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005863115_1005863126 26 Left 1005863115 6:29916549-29916571 CCACCTCTGAATGTCCAACTCAT No data
Right 1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG No data
1005863123_1005863126 -10 Left 1005863123 6:29916585-29916607 CCATGATATGCCCTAGTGGGGCA No data
Right 1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG No data
1005863122_1005863126 -9 Left 1005863122 6:29916584-29916606 CCCATGATATGCCCTAGTGGGGC No data
Right 1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG No data
1005863116_1005863126 23 Left 1005863116 6:29916552-29916574 CCTCTGAATGTCCAACTCATCAG No data
Right 1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG No data
1005863118_1005863126 12 Left 1005863118 6:29916563-29916585 CCAACTCATCAGCATTTTAGGCC No data
Right 1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005863126 Original CRISPR TAGTGGGGCACTATTTCTTT AGG Intergenic
No off target data available for this crispr