ID: 1005863216

View in Genome Browser
Species Human (GRCh38)
Location 6:29917205-29917227
Sequence TTGTGCCTGTGGAAGATCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005863216_1005863222 9 Left 1005863216 6:29917205-29917227 CCCGTGATCTTCCACAGGCACAA No data
Right 1005863222 6:29917237-29917259 AGCCTGGAGGAAACACTCTGAGG No data
1005863216_1005863219 -7 Left 1005863216 6:29917205-29917227 CCCGTGATCTTCCACAGGCACAA No data
Right 1005863219 6:29917221-29917243 GGCACAACTAAGTGCCAGCCTGG No data
1005863216_1005863223 10 Left 1005863216 6:29917205-29917227 CCCGTGATCTTCCACAGGCACAA No data
Right 1005863223 6:29917238-29917260 GCCTGGAGGAAACACTCTGAGGG No data
1005863216_1005863220 -4 Left 1005863216 6:29917205-29917227 CCCGTGATCTTCCACAGGCACAA No data
Right 1005863220 6:29917224-29917246 ACAACTAAGTGCCAGCCTGGAGG No data
1005863216_1005863225 29 Left 1005863216 6:29917205-29917227 CCCGTGATCTTCCACAGGCACAA No data
Right 1005863225 6:29917257-29917279 AGGGTTGCATGCCATCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005863216 Original CRISPR TTGTGCCTGTGGAAGATCAC GGG (reversed) Intergenic
No off target data available for this crispr