ID: 1005866287

View in Genome Browser
Species Human (GRCh38)
Location 6:29940088-29940110
Sequence TTGGTTGAATAACTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005866287_1005866295 26 Left 1005866287 6:29940088-29940110 CCTTCCTCCAGTTATTCAACCAA No data
Right 1005866295 6:29940137-29940159 GATTTAGCAGATATAATTAAGGG No data
1005866287_1005866294 25 Left 1005866287 6:29940088-29940110 CCTTCCTCCAGTTATTCAACCAA No data
Right 1005866294 6:29940136-29940158 GGATTTAGCAGATATAATTAAGG No data
1005866287_1005866293 4 Left 1005866287 6:29940088-29940110 CCTTCCTCCAGTTATTCAACCAA No data
Right 1005866293 6:29940115-29940137 AATGTAGGTGCTGCTGTGAAGGG No data
1005866287_1005866292 3 Left 1005866287 6:29940088-29940110 CCTTCCTCCAGTTATTCAACCAA No data
Right 1005866292 6:29940114-29940136 TAATGTAGGTGCTGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005866287 Original CRISPR TTGGTTGAATAACTGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr