ID: 1005866644

View in Genome Browser
Species Human (GRCh38)
Location 6:29942618-29942640
Sequence GACCCCGCACTCACCCGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 4, 1: 4, 2: 1, 3: 15, 4: 162}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005866644_1005866656 13 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866656 6:29942654-29942676 CCTCTGCGGGGAGAAGCAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 180
1005866644_1005866659 26 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866659 6:29942667-29942689 AAGCAAGGGGCCCTCCTGGCGGG 0: 1
1: 1
2: 1
3: 16
4: 196
1005866644_1005866657 22 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866657 6:29942663-29942685 GGAGAAGCAAGGGGCCCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 311
1005866644_1005866649 -1 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866649 6:29942640-29942662 CGGGAGGGAAACCGCCTCTGCGG 0: 1
1: 0
2: 4
3: 3
4: 81
1005866644_1005866654 12 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866654 6:29942653-29942675 GCCTCTGCGGGGAGAAGCAAGGG 0: 1
1: 0
2: 1
3: 24
4: 192
1005866644_1005866658 25 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866658 6:29942666-29942688 GAAGCAAGGGGCCCTCCTGGCGG 0: 1
1: 0
2: 1
3: 23
4: 242
1005866644_1005866650 0 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866650 6:29942641-29942663 GGGAGGGAAACCGCCTCTGCGGG 0: 1
1: 0
2: 3
3: 14
4: 147
1005866644_1005866661 28 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866661 6:29942669-29942691 GCAAGGGGCCCTCCTGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 204
1005866644_1005866653 11 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866653 6:29942652-29942674 CGCCTCTGCGGGGAGAAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1005866644_1005866660 27 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866660 6:29942668-29942690 AGCAAGGGGCCCTCCTGGCGGGG 0: 1
1: 0
2: 2
3: 8
4: 173
1005866644_1005866651 1 Left 1005866644 6:29942618-29942640 CCTGGGCGGGTGAGTGCGGGGTC 0: 4
1: 4
2: 1
3: 15
4: 162
Right 1005866651 6:29942642-29942664 GGAGGGAAACCGCCTCTGCGGGG 0: 1
1: 0
2: 3
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005866644 Original CRISPR GACCCCGCACTCACCCGCCC AGG (reversed) Exonic