ID: 1005868560

View in Genome Browser
Species Human (GRCh38)
Location 6:29956612-29956634
Sequence ATGGGTACACAGCTGCGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005868550_1005868560 21 Left 1005868550 6:29956568-29956590 CCTGGGCTGACCGCAGTCGCTGG No data
Right 1005868560 6:29956612-29956634 ATGGGTACACAGCTGCGACGTGG No data
1005868555_1005868560 11 Left 1005868555 6:29956578-29956600 CCGCAGTCGCTGGGAATGGGTCT No data
Right 1005868560 6:29956612-29956634 ATGGGTACACAGCTGCGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005868560 Original CRISPR ATGGGTACACAGCTGCGACG TGG Intergenic
No off target data available for this crispr