ID: 1005870470

View in Genome Browser
Species Human (GRCh38)
Location 6:29971342-29971364
Sequence TCCCTCTGGCCCCATGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005870470_1005870483 28 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870483 6:29971393-29971415 AGATGGGGCAGCCTTGGCCCTGG No data
1005870470_1005870484 29 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870484 6:29971394-29971416 GATGGGGCAGCCTTGGCCCTGGG No data
1005870470_1005870474 -9 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870474 6:29971356-29971378 CCAGAGGGAACTCTTAGGGATGG No data
1005870470_1005870478 1 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870478 6:29971366-29971388 CTCTTAGGGATGGGCAGGCTGGG No data
1005870470_1005870475 -8 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870475 6:29971357-29971379 CAGAGGGAACTCTTAGGGATGGG No data
1005870470_1005870476 -4 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870476 6:29971361-29971383 GGGAACTCTTAGGGATGGGCAGG No data
1005870470_1005870485 30 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870485 6:29971395-29971417 ATGGGGCAGCCTTGGCCCTGGGG No data
1005870470_1005870479 11 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870479 6:29971376-29971398 TGGGCAGGCTGGGAAGCAGATGG No data
1005870470_1005870477 0 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870477 6:29971365-29971387 ACTCTTAGGGATGGGCAGGCTGG No data
1005870470_1005870481 13 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870481 6:29971378-29971400 GGCAGGCTGGGAAGCAGATGGGG No data
1005870470_1005870480 12 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870480 6:29971377-29971399 GGGCAGGCTGGGAAGCAGATGGG No data
1005870470_1005870482 22 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870482 6:29971387-29971409 GGAAGCAGATGGGGCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005870470 Original CRISPR TCCCTCTGGCCCCATGTACC AGG (reversed) Intergenic