ID: 1005870475

View in Genome Browser
Species Human (GRCh38)
Location 6:29971357-29971379
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005870470_1005870475 -8 Left 1005870470 6:29971342-29971364 CCTGGTACATGGGGCCAGAGGGA No data
Right 1005870475 6:29971357-29971379 CAGAGGGAACTCTTAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005870475 Original CRISPR CAGAGGGAACTCTTAGGGAT GGG Intergenic