ID: 1005873463

View in Genome Browser
Species Human (GRCh38)
Location 6:29994545-29994567
Sequence AGCTGAGGAGTTGCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005873463_1005873478 23 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873478 6:29994591-29994613 GGCTCATGGCCCTGGTGAGGGGG No data
1005873463_1005873475 20 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873475 6:29994588-29994610 GGGGGCTCATGGCCCTGGTGAGG No data
1005873463_1005873473 9 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873473 6:29994577-29994599 TCAGCTGTGTTGGGGGCTCATGG No data
1005873463_1005873471 2 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873471 6:29994570-29994592 GGCCAGCTCAGCTGTGTTGGGGG No data
1005873463_1005873476 21 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873476 6:29994589-29994611 GGGGCTCATGGCCCTGGTGAGGG No data
1005873463_1005873474 15 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873474 6:29994583-29994605 GTGTTGGGGGCTCATGGCCCTGG No data
1005873463_1005873469 0 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873469 6:29994568-29994590 TGGGCCAGCTCAGCTGTGTTGGG No data
1005873463_1005873477 22 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873477 6:29994590-29994612 GGGCTCATGGCCCTGGTGAGGGG No data
1005873463_1005873470 1 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873470 6:29994569-29994591 GGGCCAGCTCAGCTGTGTTGGGG No data
1005873463_1005873479 28 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873479 6:29994596-29994618 ATGGCCCTGGTGAGGGGGAGTGG No data
1005873463_1005873468 -1 Left 1005873463 6:29994545-29994567 CCAGCTCCAGCAACTCCTCAGCT No data
Right 1005873468 6:29994567-29994589 TTGGGCCAGCTCAGCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005873463 Original CRISPR AGCTGAGGAGTTGCTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr