ID: 1005873796

View in Genome Browser
Species Human (GRCh38)
Location 6:29996252-29996274
Sequence CAGTGAACCAGGAGCTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005873796_1005873802 13 Left 1005873796 6:29996252-29996274 CCCTTGTAGCTCCTGGTTCACTG No data
Right 1005873802 6:29996288-29996310 CAGTGCGTCTCCTTGACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005873796 Original CRISPR CAGTGAACCAGGAGCTACAA GGG (reversed) Intergenic
No off target data available for this crispr