ID: 1005875211

View in Genome Browser
Species Human (GRCh38)
Location 6:30006260-30006282
Sequence TCTCAATGTTCCCTGAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005875211_1005875213 -2 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875213 6:30006281-30006303 GACAGAGCGTTTGTCACAGGAGG No data
1005875211_1005875214 3 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875214 6:30006286-30006308 AGCGTTTGTCACAGGAGGAGCGG No data
1005875211_1005875212 -5 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875212 6:30006278-30006300 TGAGACAGAGCGTTTGTCACAGG No data
1005875211_1005875217 10 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875217 6:30006293-30006315 GTCACAGGAGGAGCGGGGTCAGG No data
1005875211_1005875215 4 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875215 6:30006287-30006309 GCGTTTGTCACAGGAGGAGCGGG No data
1005875211_1005875216 5 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875216 6:30006288-30006310 CGTTTGTCACAGGAGGAGCGGGG No data
1005875211_1005875218 11 Left 1005875211 6:30006260-30006282 CCAAGACTCAGGGAACATTGAGA No data
Right 1005875218 6:30006294-30006316 TCACAGGAGGAGCGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005875211 Original CRISPR TCTCAATGTTCCCTGAGTCT TGG (reversed) Intergenic
No off target data available for this crispr