ID: 1005876465

View in Genome Browser
Species Human (GRCh38)
Location 6:30013714-30013736
Sequence CTGGCAGGTGCCGATGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005876465_1005876476 18 Left 1005876465 6:30013714-30013736 CCATCAACATCGGCACCTGCCAG No data
Right 1005876476 6:30013755-30013777 GTAAGGAGTGAAAAGGCCCCAGG No data
1005876465_1005876474 11 Left 1005876465 6:30013714-30013736 CCATCAACATCGGCACCTGCCAG No data
Right 1005876474 6:30013748-30013770 CCACCATGTAAGGAGTGAAAAGG No data
1005876465_1005876468 1 Left 1005876465 6:30013714-30013736 CCATCAACATCGGCACCTGCCAG No data
Right 1005876468 6:30013738-30013760 CGCCCACCACCCACCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005876465 Original CRISPR CTGGCAGGTGCCGATGTTGA TGG (reversed) Intergenic
No off target data available for this crispr